Incidental Mutation 'R1710:Mbd5'
ID 190396
Institutional Source Beutler Lab
Gene Symbol Mbd5
Ensembl Gene ENSMUSG00000036792
Gene Name methyl-CpG binding domain protein 5
Synonyms C030040A15Rik, OTTMUSG00000012483, 9430004D19Rik
MMRRC Submission 039743-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1710 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 48949508-49325405 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 49257032 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 418 (N418S)
Ref Sequence ENSEMBL: ENSMUSP00000036847 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047413] [ENSMUST00000112745] [ENSMUST00000112754]
AlphaFold B1AYB6
Predicted Effect probably benign
Transcript: ENSMUST00000047413
AA Change: N418S

PolyPhen 2 Score 0.102 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000036847
Gene: ENSMUSG00000036792
AA Change: N418S

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
Blast:MBD 24 77 9e-11 BLAST
low complexity region 332 342 N/A INTRINSIC
low complexity region 429 443 N/A INTRINSIC
low complexity region 459 467 N/A INTRINSIC
low complexity region 499 512 N/A INTRINSIC
low complexity region 535 546 N/A INTRINSIC
low complexity region 571 613 N/A INTRINSIC
low complexity region 699 719 N/A INTRINSIC
low complexity region 841 852 N/A INTRINSIC
low complexity region 912 932 N/A INTRINSIC
low complexity region 934 948 N/A INTRINSIC
low complexity region 992 1010 N/A INTRINSIC
low complexity region 1020 1035 N/A INTRINSIC
low complexity region 1112 1136 N/A INTRINSIC
low complexity region 1173 1184 N/A INTRINSIC
low complexity region 1206 1229 N/A INTRINSIC
low complexity region 1552 1562 N/A INTRINSIC
SCOP:d1khca_ 1615 1718 2e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112745
AA Change: N418S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108365
Gene: ENSMUSG00000036792
AA Change: N418S

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
Blast:MBD 24 77 4e-11 BLAST
low complexity region 332 342 N/A INTRINSIC
low complexity region 429 443 N/A INTRINSIC
low complexity region 459 467 N/A INTRINSIC
low complexity region 499 512 N/A INTRINSIC
low complexity region 535 546 N/A INTRINSIC
low complexity region 571 613 N/A INTRINSIC
low complexity region 699 719 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112754
AA Change: N418S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108374
Gene: ENSMUSG00000036792
AA Change: N418S

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
Blast:MBD 24 77 8e-11 BLAST
low complexity region 332 342 N/A INTRINSIC
low complexity region 429 443 N/A INTRINSIC
low complexity region 459 467 N/A INTRINSIC
low complexity region 499 512 N/A INTRINSIC
low complexity region 535 546 N/A INTRINSIC
low complexity region 571 613 N/A INTRINSIC
low complexity region 699 719 N/A INTRINSIC
low complexity region 841 852 N/A INTRINSIC
low complexity region 912 932 N/A INTRINSIC
low complexity region 934 948 N/A INTRINSIC
low complexity region 976 999 N/A INTRINSIC
low complexity region 1322 1332 N/A INTRINSIC
SCOP:d1khca_ 1385 1488 4e-17 SMART
Predicted Effect unknown
Transcript: ENSMUST00000122841
AA Change: N157S
SMART Domains Protein: ENSMUSP00000119317
Gene: ENSMUSG00000036792
AA Change: N157S

DomainStartEndE-ValueType
low complexity region 72 82 N/A INTRINSIC
low complexity region 169 183 N/A INTRINSIC
low complexity region 199 207 N/A INTRINSIC
low complexity region 239 252 N/A INTRINSIC
low complexity region 275 286 N/A INTRINSIC
low complexity region 311 353 N/A INTRINSIC
low complexity region 439 459 N/A INTRINSIC
low complexity region 581 592 N/A INTRINSIC
low complexity region 652 672 N/A INTRINSIC
low complexity region 674 688 N/A INTRINSIC
low complexity region 732 750 N/A INTRINSIC
low complexity region 760 775 N/A INTRINSIC
low complexity region 852 876 N/A INTRINSIC
low complexity region 913 924 N/A INTRINSIC
low complexity region 946 969 N/A INTRINSIC
low complexity region 1011 1022 N/A INTRINSIC
low complexity region 1056 1064 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199257
Meta Mutation Damage Score 0.0589 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 98% (117/120)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the methyl-CpG-binding domain (MBD) family. The MBD consists of about 70 residues and is the minimal region required for a methyl-CpG-binding protein binding specifically to methylated DNA. In addition to the MBD domain, this protein contains a PWWP domain (Pro-Trp-Trp-Pro motif), which consists of 100-150 amino acids and is found in numerous proteins that are involved in cell division, growth and differentiation. Mutations in this gene cause mental retardation autosomal dominant type 1. Haploinsufficiency of this gene is associated with a syndrome involving microcephaly, intellectual disabilities, severe speech impairment, and seizures. Alternatively spliced transcript variants have been found, but their full-length nature is not determined. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozgyous for a knock-out allele exhibit severe postnatal growth retardation leading to lethality by P22, decreased body, brain and liver weights, reduced IGF-I and GH levels, and abnormal glucose homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 114 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik A T 18: 70,468,063 S249R possibly damaging Het
9130409I23Rik A G 1: 181,051,319 M1V probably null Het
Acadvl T A 11: 70,010,355 I638F probably damaging Het
Acnat2 T A 4: 49,380,587 T264S probably benign Het
Acrv1 C T 9: 36,694,255 Q33* probably null Het
Actrt3 T A 3: 30,599,752 N33I probably damaging Het
Alyref2 T C 1: 171,503,600 probably benign Het
Ank2 C A 3: 126,933,060 E3712* probably null Het
Ano7 C A 1: 93,385,624 H161Q probably benign Het
Arhgap10 C A 8: 77,358,587 E451* probably null Het
Arhgap29 T A 3: 122,008,080 Y748N probably damaging Het
Arhgap45 C T 10: 80,018,098 Q149* probably null Het
Asap2 C T 12: 21,224,392 H371Y probably damaging Het
Atp6v1b1 T C 6: 83,758,390 I480T probably benign Het
BC034090 T C 1: 155,225,864 D218G possibly damaging Het
Brdt A T 5: 107,343,584 D74V probably damaging Het
C4b A G 17: 34,743,664 probably benign Het
Card11 T A 5: 140,902,905 K233* probably null Het
Catip T G 1: 74,362,770 F35V possibly damaging Het
Ccdc13 C T 9: 121,819,581 G247R probably damaging Het
Cep97 T A 16: 55,915,022 D471V probably damaging Het
Col17a1 A T 19: 47,670,931 L403Q probably damaging Het
Crbn A G 6: 106,790,945 S194P possibly damaging Het
Dhx58 T A 11: 100,703,574 H97L probably benign Het
Dnah8 T C 17: 30,854,940 I4528T probably damaging Het
Dpyd A G 3: 118,610,443 probably null Het
Entpd1 A T 19: 40,726,236 Q263L probably benign Het
Esyt3 T C 9: 99,336,191 I130M probably benign Het
Etv1 T C 12: 38,852,262 F264S probably benign Het
Fam189a2 A T 19: 23,979,695 I317N probably damaging Het
Fam196b T A 11: 34,404,263 probably null Het
Fam45a A G 19: 60,817,583 Y102C probably damaging Het
Fat1 T C 8: 45,010,482 S1354P probably benign Het
Fat4 C A 3: 38,951,155 T1901N probably damaging Het
Fbxw13 C T 9: 109,181,518 V351I probably damaging Het
Fmo3 A G 1: 162,967,787 F160L possibly damaging Het
Fyb2 T A 4: 105,003,916 D592E probably damaging Het
Gjb4 T C 4: 127,351,870 M93V possibly damaging Het
Gm5089 C A 14: 122,436,154 G52* probably null Het
Gm6401 G T 14: 41,966,883 N76K probably benign Het
Gm6871 A G 7: 41,546,477 S279P probably damaging Het
Gtf2ird2 T G 5: 134,211,240 V301G probably benign Het
H2bfm A C X: 136,927,467 D35A unknown Het
Hfm1 A G 5: 106,880,514 F817L probably damaging Het
Hfm1 T C 5: 106,896,003 E589G probably damaging Het
Hivep2 A T 10: 14,129,505 K616* probably null Het
Hmcn1 A T 1: 150,675,984 I2623N probably damaging Het
Igf2bp3 G T 6: 49,105,631 A339E probably damaging Het
Irx4 T C 13: 73,267,638 I182T possibly damaging Het
Jcad T C 18: 4,674,511 S758P probably damaging Het
Klhdc4 A T 8: 121,799,487 Y304* probably null Het
Lama1 A G 17: 67,753,791 I705V probably benign Het
Mmp21 C T 7: 133,677,285 V279I probably damaging Het
Morc4 A C X: 139,854,530 C272W probably damaging Het
Mrm1 A T 11: 84,818,692 C180S probably damaging Het
Ncor1 T C 11: 62,423,005 D103G probably damaging Het
Ndrg4 A G 8: 95,710,686 D251G probably damaging Het
Ndufaf5 T C 2: 140,193,602 V246A possibly damaging Het
Noa1 T C 5: 77,309,725 E111G possibly damaging Het
Nod1 C A 6: 54,944,059 V425F probably damaging Het
Nos1 A T 5: 117,895,919 I369F probably damaging Het
Nsun5 C T 5: 135,371,316 H98Y probably damaging Het
Olfr1013 C T 2: 85,769,855 T18I probably benign Het
Olfr172 A G 16: 58,761,141 F12L probably benign Het
Olfr292 G A 7: 86,695,110 R218H probably benign Het
Olfr726 C G 14: 50,084,370 V104L probably benign Het
Olfr933 A G 9: 38,975,906 I77V probably damaging Het
Olfr945 T C 9: 39,258,571 I37V probably benign Het
Optn G A 2: 5,053,130 T76I possibly damaging Het
Oscar C T 7: 3,611,856 W22* probably null Het
Palmd T A 3: 116,923,657 Y397F probably damaging Het
Plk1 A G 7: 122,168,898 D447G probably damaging Het
Plscr5 T A 9: 92,205,528 N183K probably damaging Het
Polk T G 13: 96,489,204 D364A probably damaging Het
Polr3d T C 14: 70,443,010 T36A probably benign Het
Ppp1r10 A T 17: 35,926,536 R199S probably damaging Het
Prkcz C T 4: 155,262,512 D388N probably damaging Het
Prrc2b T C 2: 32,212,222 L769P probably damaging Het
Psg26 A G 7: 18,480,041 V232A probably damaging Het
Pth2r T C 1: 65,336,838 V85A possibly damaging Het
Rbpms2 T C 9: 65,659,212 probably benign Het
Reps1 A T 10: 18,118,950 D514V possibly damaging Het
Riok3 G T 18: 12,142,961 R238L probably benign Het
Rnf19a T C 15: 36,244,207 Q569R probably damaging Het
Rorb G A 19: 18,960,501 T267I probably damaging Het
Rrm2b A T 15: 37,929,096 M70K probably damaging Het
Rsf1 A T 7: 97,662,349 E762V possibly damaging Het
S100a2 G A 3: 90,591,392 V67I probably benign Het
Skp1a T A 11: 52,242,615 D42E probably benign Het
Slc22a4 A T 11: 54,027,975 M1K probably null Het
Slc2a9 T A 5: 38,382,044 Q371L probably damaging Het
Slc4a9 A G 18: 36,532,022 T475A probably benign Het
Slc8b1 A G 5: 120,519,652 N60S probably damaging Het
Slx4 A C 16: 3,999,158 D66E probably benign Het
Smg8 A T 11: 87,086,287 I156N probably damaging Het
Snx25 A T 8: 46,116,207 C218S possibly damaging Het
Sulf2 T C 2: 166,079,072 I784V probably benign Het
Tatdn2 G T 6: 113,697,927 R72L possibly damaging Het
Tbc1d8 T C 1: 39,406,837 D91G possibly damaging Het
Tifab C A 13: 56,176,620 R3S probably benign Het
Tm4sf1 A T 3: 57,292,883 S104T probably damaging Het
Tmem132e T A 11: 82,443,517 I618N probably damaging Het
Ttc7b A T 12: 100,403,408 D367E probably damaging Het
Txlnb A G 10: 17,843,455 D678G possibly damaging Het
Vgll4 A G 6: 114,957,934 probably null Het
Vmn2r124 A T 17: 18,061,925 probably benign Het
Vmn2r2 T C 3: 64,117,399 D587G probably benign Het
Vmn2r84 G A 10: 130,391,099 A290V probably benign Het
Vps13c T A 9: 67,911,529 S1077R probably benign Het
Vsig10 C T 5: 117,351,654 A495V probably benign Het
Vwa3a A T 7: 120,804,031 probably null Het
Zfhx2 C A 14: 55,065,998 A1510S possibly damaging Het
Zfp142 T A 1: 74,572,230 D601V probably damaging Het
Zfp62 T C 11: 49,217,683 I867T probably benign Het
Other mutations in Mbd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01385:Mbd5 APN 2 49250221 missense possibly damaging 0.92
IGL01481:Mbd5 APN 2 49278939 missense possibly damaging 0.90
IGL01639:Mbd5 APN 2 49272308 missense probably damaging 0.98
IGL02063:Mbd5 APN 2 49274767 missense probably damaging 1.00
IGL02157:Mbd5 APN 2 49278975 missense probably benign
IGL02510:Mbd5 APN 2 49257029 missense probably benign 0.05
IGL02932:Mbd5 APN 2 49279448 missense possibly damaging 0.66
IGL02973:Mbd5 APN 2 49313709 missense probably damaging 0.99
IGL03189:Mbd5 APN 2 49257751 missense probably damaging 0.98
BB003:Mbd5 UTSW 2 49256323 missense probably damaging 0.99
BB013:Mbd5 UTSW 2 49256323 missense probably damaging 0.99
F5770:Mbd5 UTSW 2 49316410 missense probably damaging 0.99
R0391:Mbd5 UTSW 2 49272416 missense possibly damaging 0.90
R0427:Mbd5 UTSW 2 49279079 missense probably benign 0.27
R0544:Mbd5 UTSW 2 49257209 missense possibly damaging 0.54
R0883:Mbd5 UTSW 2 49256689 missense possibly damaging 0.94
R1072:Mbd5 UTSW 2 49257191 missense probably damaging 1.00
R1099:Mbd5 UTSW 2 49258144 missense probably benign 0.06
R1400:Mbd5 UTSW 2 49274776 critical splice donor site probably null
R1497:Mbd5 UTSW 2 49257381 missense possibly damaging 0.73
R1552:Mbd5 UTSW 2 49272934 missense probably damaging 0.99
R1675:Mbd5 UTSW 2 49256218 missense possibly damaging 0.90
R2085:Mbd5 UTSW 2 49279311 missense possibly damaging 0.90
R2252:Mbd5 UTSW 2 49257686 missense probably damaging 1.00
R2473:Mbd5 UTSW 2 49279341 missense probably benign 0.06
R3966:Mbd5 UTSW 2 49272070 missense possibly damaging 0.46
R4278:Mbd5 UTSW 2 49272293 missense probably damaging 0.97
R4348:Mbd5 UTSW 2 49256327 missense probably benign
R4366:Mbd5 UTSW 2 49272966 missense probably damaging 0.99
R4428:Mbd5 UTSW 2 49279764 missense possibly damaging 0.94
R4556:Mbd5 UTSW 2 49279394 missense probably damaging 1.00
R4600:Mbd5 UTSW 2 49257197 missense probably benign 0.31
R4689:Mbd5 UTSW 2 49258279 missense possibly damaging 0.46
R4707:Mbd5 UTSW 2 49250156 missense probably damaging 0.99
R4718:Mbd5 UTSW 2 49256402 missense possibly damaging 0.66
R4773:Mbd5 UTSW 2 49274611 missense probably damaging 1.00
R4846:Mbd5 UTSW 2 49256997 missense probably damaging 1.00
R5015:Mbd5 UTSW 2 49258196 missense possibly damaging 0.92
R5059:Mbd5 UTSW 2 49256455 missense probably damaging 0.96
R5268:Mbd5 UTSW 2 49272094 missense possibly damaging 0.92
R5479:Mbd5 UTSW 2 49272905 missense probably damaging 0.99
R5579:Mbd5 UTSW 2 49272814 missense possibly damaging 0.94
R5591:Mbd5 UTSW 2 49274669 missense probably damaging 1.00
R5876:Mbd5 UTSW 2 49274645 missense probably damaging 0.98
R5886:Mbd5 UTSW 2 49272452 missense probably damaging 1.00
R5973:Mbd5 UTSW 2 49272389 missense probably benign 0.23
R6935:Mbd5 UTSW 2 49279812 missense probably damaging 0.97
R7317:Mbd5 UTSW 2 49279743 missense probably benign
R7366:Mbd5 UTSW 2 49274568 missense probably benign
R7385:Mbd5 UTSW 2 49272449 missense probably benign 0.01
R7402:Mbd5 UTSW 2 49257554 missense probably damaging 1.00
R7462:Mbd5 UTSW 2 49257880 missense possibly damaging 0.52
R7549:Mbd5 UTSW 2 49251343 missense probably damaging 0.97
R7916:Mbd5 UTSW 2 49257106 missense probably damaging 0.99
R7926:Mbd5 UTSW 2 49256323 missense probably damaging 0.99
R7960:Mbd5 UTSW 2 49279784 critical splice donor site probably null
R8273:Mbd5 UTSW 2 49278879 missense probably damaging 0.99
R8909:Mbd5 UTSW 2 49279221 missense probably benign 0.13
R9121:Mbd5 UTSW 2 49258090 missense possibly damaging 0.59
R9149:Mbd5 UTSW 2 49251376 missense probably damaging 0.98
R9443:Mbd5 UTSW 2 49256700 missense probably damaging 0.99
R9506:Mbd5 UTSW 2 49272907 missense probably damaging 0.96
R9566:Mbd5 UTSW 2 49279509 missense probably damaging 0.96
V7583:Mbd5 UTSW 2 49316410 missense probably damaging 0.99
Z1176:Mbd5 UTSW 2 49279308 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCCTGTGCAATGGCTGGAAGAAC -3'
(R):5'- CAGACTTGGTAGAAGGGCTTGATGG -3'

Sequencing Primer
(F):5'- TCTGAGAAAGATCCACTTGGC -3'
(R):5'- GTGGAACCTTTATGCCACTACAAG -3'
Posted On 2014-05-14