Incidental Mutation 'R1710:Noa1'
ID190416
Institutional Source Beutler Lab
Gene Symbol Noa1
Ensembl Gene ENSMUSG00000036285
Gene Namenitric oxide associated 1
Synonyms2610024G14Rik, mAtNOS1
MMRRC Submission 039743-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1710 (G1)
Quality Score107
Status Validated
Chromosome5
Chromosomal Location77294182-77310084 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 77309725 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 111 (E111G)
Ref Sequence ENSEMBL: ENSMUSP00000045948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031167] [ENSMUST00000047860]
Predicted Effect probably benign
Transcript: ENSMUST00000031167
SMART Domains Protein: ENSMUSP00000031167
Gene: ENSMUSG00000029250

DomainStartEndE-ValueType
low complexity region 1 16 N/A INTRINSIC
Pfam:RNA_pol_Rpb2_1 38 442 2.5e-69 PFAM
Pfam:RNA_pol_Rpb2_2 201 394 3.7e-57 PFAM
Pfam:RNA_pol_Rpb2_3 468 532 6.1e-25 PFAM
Pfam:RNA_pol_Rpb2_4 567 629 7.4e-27 PFAM
Pfam:RNA_pol_Rpb2_5 653 700 1.6e-22 PFAM
Pfam:RNA_pol_Rpb2_6 707 1080 4.5e-129 PFAM
Pfam:RNA_pol_Rpb2_7 1082 1174 3.3e-35 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000047860
AA Change: E111G

PolyPhen 2 Score 0.491 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000045948
Gene: ENSMUSG00000036285
AA Change: E111G

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
coiled coil region 83 125 N/A INTRINSIC
low complexity region 224 238 N/A INTRINSIC
Pfam:MMR_HSR1 342 526 6.5e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138121
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139435
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150722
Meta Mutation Damage Score 0.1065 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 98% (117/120)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear-encoded GTPase that functions in the mitochondrion. Upon translation, this protein is imported into the nucleus and then into the nucleolus before being exported to the mitochondrion. The encoded protein is required for oxygen-dependent regulation of mitochondrial respiratory complexes and for mitochondrial protein synthesis. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality during organogenesis associated with developmental retardation, decreased cell proliferation and apoptosis, increased cell necrosis, and abnormal mitochondrial morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 114 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik A T 18: 70,468,063 S249R possibly damaging Het
9130409I23Rik A G 1: 181,051,319 M1V probably null Het
Acadvl T A 11: 70,010,355 I638F probably damaging Het
Acnat2 T A 4: 49,380,587 T264S probably benign Het
Acrv1 C T 9: 36,694,255 Q33* probably null Het
Actrt3 T A 3: 30,599,752 N33I probably damaging Het
Alyref2 T C 1: 171,503,600 probably benign Het
Ank2 C A 3: 126,933,060 E3712* probably null Het
Ano7 C A 1: 93,385,624 H161Q probably benign Het
Arhgap10 C A 8: 77,358,587 E451* probably null Het
Arhgap29 T A 3: 122,008,080 Y748N probably damaging Het
Arhgap45 C T 10: 80,018,098 Q149* probably null Het
Asap2 C T 12: 21,224,392 H371Y probably damaging Het
Atp6v1b1 T C 6: 83,758,390 I480T probably benign Het
BC034090 T C 1: 155,225,864 D218G possibly damaging Het
Brdt A T 5: 107,343,584 D74V probably damaging Het
C4b A G 17: 34,743,664 probably benign Het
Card11 T A 5: 140,902,905 K233* probably null Het
Catip T G 1: 74,362,770 F35V possibly damaging Het
Ccdc13 C T 9: 121,819,581 G247R probably damaging Het
Cep97 T A 16: 55,915,022 D471V probably damaging Het
Col17a1 A T 19: 47,670,931 L403Q probably damaging Het
Crbn A G 6: 106,790,945 S194P possibly damaging Het
Dhx58 T A 11: 100,703,574 H97L probably benign Het
Dnah8 T C 17: 30,854,940 I4528T probably damaging Het
Dpyd A G 3: 118,610,443 probably null Het
Entpd1 A T 19: 40,726,236 Q263L probably benign Het
Esyt3 T C 9: 99,336,191 I130M probably benign Het
Etv1 T C 12: 38,852,262 F264S probably benign Het
Fam189a2 A T 19: 23,979,695 I317N probably damaging Het
Fam196b T A 11: 34,404,263 probably null Het
Fam45a A G 19: 60,817,583 Y102C probably damaging Het
Fat1 T C 8: 45,010,482 S1354P probably benign Het
Fat4 C A 3: 38,951,155 T1901N probably damaging Het
Fbxw13 C T 9: 109,181,518 V351I probably damaging Het
Fmo3 A G 1: 162,967,787 F160L possibly damaging Het
Fyb2 T A 4: 105,003,916 D592E probably damaging Het
Gjb4 T C 4: 127,351,870 M93V possibly damaging Het
Gm5089 C A 14: 122,436,154 G52* probably null Het
Gm6401 G T 14: 41,966,883 N76K probably benign Het
Gm6871 A G 7: 41,546,477 S279P probably damaging Het
Gtf2ird2 T G 5: 134,211,240 V301G probably benign Het
H2bfm A C X: 136,927,467 D35A unknown Het
Hfm1 A G 5: 106,880,514 F817L probably damaging Het
Hfm1 T C 5: 106,896,003 E589G probably damaging Het
Hivep2 A T 10: 14,129,505 K616* probably null Het
Hmcn1 A T 1: 150,675,984 I2623N probably damaging Het
Igf2bp3 G T 6: 49,105,631 A339E probably damaging Het
Irx4 T C 13: 73,267,638 I182T possibly damaging Het
Jcad T C 18: 4,674,511 S758P probably damaging Het
Klhdc4 A T 8: 121,799,487 Y304* probably null Het
Lama1 A G 17: 67,753,791 I705V probably benign Het
Mbd5 A G 2: 49,257,032 N418S probably benign Het
Mmp21 C T 7: 133,677,285 V279I probably damaging Het
Morc4 A C X: 139,854,530 C272W probably damaging Het
Mrm1 A T 11: 84,818,692 C180S probably damaging Het
Ncor1 T C 11: 62,423,005 D103G probably damaging Het
Ndrg4 A G 8: 95,710,686 D251G probably damaging Het
Ndufaf5 T C 2: 140,193,602 V246A possibly damaging Het
Nod1 C A 6: 54,944,059 V425F probably damaging Het
Nos1 A T 5: 117,895,919 I369F probably damaging Het
Nsun5 C T 5: 135,371,316 H98Y probably damaging Het
Olfr1013 C T 2: 85,769,855 T18I probably benign Het
Olfr172 A G 16: 58,761,141 F12L probably benign Het
Olfr292 G A 7: 86,695,110 R218H probably benign Het
Olfr726 C G 14: 50,084,370 V104L probably benign Het
Olfr933 A G 9: 38,975,906 I77V probably damaging Het
Olfr945 T C 9: 39,258,571 I37V probably benign Het
Optn G A 2: 5,053,130 T76I possibly damaging Het
Oscar C T 7: 3,611,856 W22* probably null Het
Palmd T A 3: 116,923,657 Y397F probably damaging Het
Plk1 A G 7: 122,168,898 D447G probably damaging Het
Plscr5 T A 9: 92,205,528 N183K probably damaging Het
Polk T G 13: 96,489,204 D364A probably damaging Het
Polr3d T C 14: 70,443,010 T36A probably benign Het
Ppp1r10 A T 17: 35,926,536 R199S probably damaging Het
Prkcz C T 4: 155,262,512 D388N probably damaging Het
Prrc2b T C 2: 32,212,222 L769P probably damaging Het
Psg26 A G 7: 18,480,041 V232A probably damaging Het
Pth2r T C 1: 65,336,838 V85A possibly damaging Het
Rbpms2 T C 9: 65,659,212 probably benign Het
Reps1 A T 10: 18,118,950 D514V possibly damaging Het
Riok3 G T 18: 12,142,961 R238L probably benign Het
Rnf19a T C 15: 36,244,207 Q569R probably damaging Het
Rorb G A 19: 18,960,501 T267I probably damaging Het
Rrm2b A T 15: 37,929,096 M70K probably damaging Het
Rsf1 A T 7: 97,662,349 E762V possibly damaging Het
S100a2 G A 3: 90,591,392 V67I probably benign Het
Skp1a T A 11: 52,242,615 D42E probably benign Het
Slc22a4 A T 11: 54,027,975 M1K probably null Het
Slc2a9 T A 5: 38,382,044 Q371L probably damaging Het
Slc4a9 A G 18: 36,532,022 T475A probably benign Het
Slc8b1 A G 5: 120,519,652 N60S probably damaging Het
Slx4 A C 16: 3,999,158 D66E probably benign Het
Smg8 A T 11: 87,086,287 I156N probably damaging Het
Snx25 A T 8: 46,116,207 C218S possibly damaging Het
Sulf2 T C 2: 166,079,072 I784V probably benign Het
Tatdn2 G T 6: 113,697,927 R72L possibly damaging Het
Tbc1d8 T C 1: 39,406,837 D91G possibly damaging Het
Tifab C A 13: 56,176,620 R3S probably benign Het
Tm4sf1 A T 3: 57,292,883 S104T probably damaging Het
Tmem132e T A 11: 82,443,517 I618N probably damaging Het
Ttc7b A T 12: 100,403,408 D367E probably damaging Het
Txlnb A G 10: 17,843,455 D678G possibly damaging Het
Vgll4 A G 6: 114,957,934 probably null Het
Vmn2r124 A T 17: 18,061,925 probably benign Het
Vmn2r2 T C 3: 64,117,399 D587G probably benign Het
Vmn2r84 G A 10: 130,391,099 A290V probably benign Het
Vps13c T A 9: 67,911,529 S1077R probably benign Het
Vsig10 C T 5: 117,351,654 A495V probably benign Het
Vwa3a A T 7: 120,804,031 probably null Het
Zfhx2 C A 14: 55,065,998 A1510S possibly damaging Het
Zfp142 T A 1: 74,572,230 D601V probably damaging Het
Zfp62 T C 11: 49,217,683 I867T probably benign Het
Other mutations in Noa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02119:Noa1 APN 5 77307579 missense probably benign
IGL02850:Noa1 APN 5 77294491 missense probably benign 0.14
R0149:Noa1 UTSW 5 77297173 nonsense probably null
R0361:Noa1 UTSW 5 77297173 nonsense probably null
R0645:Noa1 UTSW 5 77309875 missense probably benign 0.00
R1226:Noa1 UTSW 5 77307555 missense possibly damaging 0.82
R1721:Noa1 UTSW 5 77307581 missense probably benign 0.00
R1732:Noa1 UTSW 5 77306374 missense probably benign 0.01
R2061:Noa1 UTSW 5 77304187 missense possibly damaging 0.64
R2262:Noa1 UTSW 5 77309804 nonsense probably null
R2965:Noa1 UTSW 5 77306344 missense possibly damaging 0.79
R2966:Noa1 UTSW 5 77306344 missense possibly damaging 0.79
R4405:Noa1 UTSW 5 77306372 missense probably benign 0.00
R4664:Noa1 UTSW 5 77299753 missense probably benign 0.31
R4849:Noa1 UTSW 5 77306332 missense possibly damaging 0.61
R4920:Noa1 UTSW 5 77306487 splice site probably null
R5005:Noa1 UTSW 5 77309026 missense probably damaging 1.00
R5325:Noa1 UTSW 5 77304195 missense probably damaging 1.00
R6112:Noa1 UTSW 5 77309746 missense probably benign 0.01
R6254:Noa1 UTSW 5 77309669 missense probably benign 0.12
R7659:Noa1 UTSW 5 77309390 missense not run
R7810:Noa1 UTSW 5 77309224 missense probably damaging 0.99
R7879:Noa1 UTSW 5 77297197 missense probably benign 0.01
R7911:Noa1 UTSW 5 77309830 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACAAGCTCCAGGTACTGATCGC -3'
(R):5'- TCGAGTTTCAGAGCTGTCATCGC -3'

Sequencing Primer
(F):5'- AGGTACTGATCGCGGCTTAC -3'
(R):5'- AGCGTGCATCATCCTTGG -3'
Posted On2014-05-14