Incidental Mutation 'R1710:Hfm1'
ID190418
Institutional Source Beutler Lab
Gene Symbol Hfm1
Ensembl Gene ENSMUSG00000043410
Gene NameHFM1, ATP-dependent DNA helicase homolog
SynonymsLOC381663, A330009G12Rik, Mer3, Sec63d1
MMRRC Submission 039743-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R1710 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location106840192-106926321 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106896003 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 589 (E589G)
Ref Sequence ENSEMBL: ENSMUSP00000112590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112690] [ENSMUST00000117588] [ENSMUST00000148495]
Predicted Effect probably damaging
Transcript: ENSMUST00000112690
AA Change: E589G

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108310
Gene: ENSMUSG00000043410
AA Change: E589G

DomainStartEndE-ValueType
DEXDc 276 490 3.66e-29 SMART
HELICc 571 657 1.56e-14 SMART
low complexity region 751 764 N/A INTRINSIC
Sec63 775 1090 5.66e-60 SMART
Blast:Sec63 1130 1188 2e-18 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000117588
AA Change: E589G

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112590
Gene: ENSMUSG00000043410
AA Change: E589G

DomainStartEndE-ValueType
DEXDc 276 490 3.66e-29 SMART
HELICc 571 657 1.56e-14 SMART
low complexity region 751 764 N/A INTRINSIC
Sec63 775 1090 5.66e-60 SMART
Blast:Sec63 1130 1188 2e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000148495
Meta Mutation Damage Score 0.1126 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 98% (117/120)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be an ATP-dependent DNA helicase and is expressed mainly in germ-line cells. Defects in this gene are a cause of premature ovarian failure 9 (POF9). [provided by RefSeq, Apr 2014]
PHENOTYPE: Meiosis ais disrupted in homozygotes and bothe sexes are sterile [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik A T 18: 70,468,063 S249R possibly damaging Het
9130409I23Rik A G 1: 181,051,319 M1V probably null Het
Acadvl T A 11: 70,010,355 I638F probably damaging Het
Acnat2 T A 4: 49,380,587 T264S probably benign Het
Acrv1 C T 9: 36,694,255 Q33* probably null Het
Actrt3 T A 3: 30,599,752 N33I probably damaging Het
Alyref2 T C 1: 171,503,600 probably benign Het
Ank2 C A 3: 126,933,060 E3712* probably null Het
Ano7 C A 1: 93,385,624 H161Q probably benign Het
Arhgap10 C A 8: 77,358,587 E451* probably null Het
Arhgap29 T A 3: 122,008,080 Y748N probably damaging Het
Arhgap45 C T 10: 80,018,098 Q149* probably null Het
Asap2 C T 12: 21,224,392 H371Y probably damaging Het
Atp6v1b1 T C 6: 83,758,390 I480T probably benign Het
BC034090 T C 1: 155,225,864 D218G possibly damaging Het
Brdt A T 5: 107,343,584 D74V probably damaging Het
C4b A G 17: 34,743,664 probably benign Het
Card11 T A 5: 140,902,905 K233* probably null Het
Catip T G 1: 74,362,770 F35V possibly damaging Het
Ccdc13 C T 9: 121,819,581 G247R probably damaging Het
Cep97 T A 16: 55,915,022 D471V probably damaging Het
Col17a1 A T 19: 47,670,931 L403Q probably damaging Het
Crbn A G 6: 106,790,945 S194P possibly damaging Het
Dhx58 T A 11: 100,703,574 H97L probably benign Het
Dnah8 T C 17: 30,854,940 I4528T probably damaging Het
Dpyd A G 3: 118,610,443 probably null Het
Entpd1 A T 19: 40,726,236 Q263L probably benign Het
Esyt3 T C 9: 99,336,191 I130M probably benign Het
Etv1 T C 12: 38,852,262 F264S probably benign Het
Fam189a2 A T 19: 23,979,695 I317N probably damaging Het
Fam196b T A 11: 34,404,263 probably null Het
Fam45a A G 19: 60,817,583 Y102C probably damaging Het
Fat1 T C 8: 45,010,482 S1354P probably benign Het
Fat4 C A 3: 38,951,155 T1901N probably damaging Het
Fbxw13 C T 9: 109,181,518 V351I probably damaging Het
Fmo3 A G 1: 162,967,787 F160L possibly damaging Het
Fyb2 T A 4: 105,003,916 D592E probably damaging Het
Gjb4 T C 4: 127,351,870 M93V possibly damaging Het
Gm5089 C A 14: 122,436,154 G52* probably null Het
Gm6401 G T 14: 41,966,883 N76K probably benign Het
Gm6871 A G 7: 41,546,477 S279P probably damaging Het
Gtf2ird2 T G 5: 134,211,240 V301G probably benign Het
H2bfm A C X: 136,927,467 D35A unknown Het
Hivep2 A T 10: 14,129,505 K616* probably null Het
Hmcn1 A T 1: 150,675,984 I2623N probably damaging Het
Igf2bp3 G T 6: 49,105,631 A339E probably damaging Het
Irx4 T C 13: 73,267,638 I182T possibly damaging Het
Jcad T C 18: 4,674,511 S758P probably damaging Het
Klhdc4 A T 8: 121,799,487 Y304* probably null Het
Lama1 A G 17: 67,753,791 I705V probably benign Het
Mbd5 A G 2: 49,257,032 N418S probably benign Het
Mmp21 C T 7: 133,677,285 V279I probably damaging Het
Morc4 A C X: 139,854,530 C272W probably damaging Het
Mrm1 A T 11: 84,818,692 C180S probably damaging Het
Ncor1 T C 11: 62,423,005 D103G probably damaging Het
Ndrg4 A G 8: 95,710,686 D251G probably damaging Het
Ndufaf5 T C 2: 140,193,602 V246A possibly damaging Het
Noa1 T C 5: 77,309,725 E111G possibly damaging Het
Nod1 C A 6: 54,944,059 V425F probably damaging Het
Nos1 A T 5: 117,895,919 I369F probably damaging Het
Nsun5 C T 5: 135,371,316 H98Y probably damaging Het
Olfr1013 C T 2: 85,769,855 T18I probably benign Het
Olfr172 A G 16: 58,761,141 F12L probably benign Het
Olfr292 G A 7: 86,695,110 R218H probably benign Het
Olfr726 C G 14: 50,084,370 V104L probably benign Het
Olfr933 A G 9: 38,975,906 I77V probably damaging Het
Olfr945 T C 9: 39,258,571 I37V probably benign Het
Optn G A 2: 5,053,130 T76I possibly damaging Het
Oscar C T 7: 3,611,856 W22* probably null Het
Palmd T A 3: 116,923,657 Y397F probably damaging Het
Plk1 A G 7: 122,168,898 D447G probably damaging Het
Plscr5 T A 9: 92,205,528 N183K probably damaging Het
Polk T G 13: 96,489,204 D364A probably damaging Het
Polr3d T C 14: 70,443,010 T36A probably benign Het
Ppp1r10 A T 17: 35,926,536 R199S probably damaging Het
Prkcz C T 4: 155,262,512 D388N probably damaging Het
Prrc2b T C 2: 32,212,222 L769P probably damaging Het
Psg26 A G 7: 18,480,041 V232A probably damaging Het
Pth2r T C 1: 65,336,838 V85A possibly damaging Het
Rbpms2 T C 9: 65,659,212 probably benign Het
Reps1 A T 10: 18,118,950 D514V possibly damaging Het
Riok3 G T 18: 12,142,961 R238L probably benign Het
Rnf19a T C 15: 36,244,207 Q569R probably damaging Het
Rorb G A 19: 18,960,501 T267I probably damaging Het
Rrm2b A T 15: 37,929,096 M70K probably damaging Het
Rsf1 A T 7: 97,662,349 E762V possibly damaging Het
S100a2 G A 3: 90,591,392 V67I probably benign Het
Skp1a T A 11: 52,242,615 D42E probably benign Het
Slc22a4 A T 11: 54,027,975 M1K probably null Het
Slc2a9 T A 5: 38,382,044 Q371L probably damaging Het
Slc4a9 A G 18: 36,532,022 T475A probably benign Het
Slc8b1 A G 5: 120,519,652 N60S probably damaging Het
Slx4 A C 16: 3,999,158 D66E probably benign Het
Smg8 A T 11: 87,086,287 I156N probably damaging Het
Snx25 A T 8: 46,116,207 C218S possibly damaging Het
Sulf2 T C 2: 166,079,072 I784V probably benign Het
Tatdn2 G T 6: 113,697,927 R72L possibly damaging Het
Tbc1d8 T C 1: 39,406,837 D91G possibly damaging Het
Tifab C A 13: 56,176,620 R3S probably benign Het
Tm4sf1 A T 3: 57,292,883 S104T probably damaging Het
Tmem132e T A 11: 82,443,517 I618N probably damaging Het
Ttc7b A T 12: 100,403,408 D367E probably damaging Het
Txlnb A G 10: 17,843,455 D678G possibly damaging Het
Vgll4 A G 6: 114,957,934 probably null Het
Vmn2r124 A T 17: 18,061,925 probably benign Het
Vmn2r2 T C 3: 64,117,399 D587G probably benign Het
Vmn2r84 G A 10: 130,391,099 A290V probably benign Het
Vps13c T A 9: 67,911,529 S1077R probably benign Het
Vsig10 C T 5: 117,351,654 A495V probably benign Het
Vwa3a A T 7: 120,804,031 probably null Het
Zfhx2 C A 14: 55,065,998 A1510S possibly damaging Het
Zfp142 T A 1: 74,572,230 D601V probably damaging Het
Zfp62 T C 11: 49,217,683 I867T probably benign Het
Other mutations in Hfm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Hfm1 APN 5 106902130 missense possibly damaging 0.70
IGL01295:Hfm1 APN 5 106917606 missense possibly damaging 0.46
IGL01725:Hfm1 APN 5 106917379 missense probably benign 0.00
IGL01758:Hfm1 APN 5 106904793 missense probably damaging 0.99
IGL01911:Hfm1 APN 5 106911544 missense possibly damaging 0.92
IGL02337:Hfm1 APN 5 106904267 missense possibly damaging 0.81
IGL02472:Hfm1 APN 5 106873928 splice site probably benign
IGL02496:Hfm1 APN 5 106901761 missense probably benign 0.00
IGL02545:Hfm1 APN 5 106895287 missense probably damaging 1.00
IGL02584:Hfm1 APN 5 106878662 splice site probably null
IGL02728:Hfm1 APN 5 106878823 missense probably benign 0.13
IGL02881:Hfm1 APN 5 106874252 missense probably damaging 1.00
IGL03108:Hfm1 APN 5 106895934 unclassified probably benign
IGL03351:Hfm1 APN 5 106911575 nonsense probably null
IGL03353:Hfm1 APN 5 106856929 missense probably damaging 0.99
R0024:Hfm1 UTSW 5 106856924 missense probably benign 0.41
R0024:Hfm1 UTSW 5 106856924 missense probably benign 0.41
R0094:Hfm1 UTSW 5 106917478 missense probably benign
R0633:Hfm1 UTSW 5 106917601 missense possibly damaging 0.56
R0644:Hfm1 UTSW 5 106898256 critical splice donor site probably null
R1078:Hfm1 UTSW 5 106878830 missense probably damaging 1.00
R1120:Hfm1 UTSW 5 106904218 splice site probably benign
R1166:Hfm1 UTSW 5 106911411 missense probably benign 0.00
R1242:Hfm1 UTSW 5 106874901 missense probably damaging 0.99
R1414:Hfm1 UTSW 5 106872353 missense probably benign 0.01
R1450:Hfm1 UTSW 5 106918458 missense probably damaging 0.99
R1529:Hfm1 UTSW 5 106853123 missense probably benign 0.00
R1622:Hfm1 UTSW 5 106893523 missense possibly damaging 0.58
R1710:Hfm1 UTSW 5 106880514 missense probably damaging 1.00
R1757:Hfm1 UTSW 5 106880360 splice site probably null
R1856:Hfm1 UTSW 5 106847676 missense probably benign 0.00
R1984:Hfm1 UTSW 5 106898576 missense probably damaging 0.98
R1985:Hfm1 UTSW 5 106898576 missense probably damaging 0.98
R2040:Hfm1 UTSW 5 106901818 missense probably damaging 1.00
R2122:Hfm1 UTSW 5 106896255 missense probably damaging 1.00
R2426:Hfm1 UTSW 5 106847653 splice site probably null
R2474:Hfm1 UTSW 5 106872416 missense possibly damaging 0.81
R2926:Hfm1 UTSW 5 106874282 nonsense probably null
R2944:Hfm1 UTSW 5 106872330 missense probably damaging 1.00
R3705:Hfm1 UTSW 5 106892839 unclassified probably benign
R4256:Hfm1 UTSW 5 106904797 missense possibly damaging 0.83
R4455:Hfm1 UTSW 5 106886508 splice site probably null
R4538:Hfm1 UTSW 5 106874890 missense possibly damaging 0.47
R4540:Hfm1 UTSW 5 106874221 nonsense probably null
R4591:Hfm1 UTSW 5 106847667 missense probably benign 0.08
R4745:Hfm1 UTSW 5 106901843 missense possibly damaging 0.87
R4747:Hfm1 UTSW 5 106917523 missense probably benign
R4765:Hfm1 UTSW 5 106842539 missense probably benign 0.21
R4821:Hfm1 UTSW 5 106854740 critical splice donor site probably null
R4842:Hfm1 UTSW 5 106892751 missense probably damaging 1.00
R4944:Hfm1 UTSW 5 106874213 missense possibly damaging 0.46
R5093:Hfm1 UTSW 5 106901731 missense probably damaging 1.00
R5399:Hfm1 UTSW 5 106917562 missense possibly damaging 0.91
R5414:Hfm1 UTSW 5 106902076 missense probably damaging 1.00
R5436:Hfm1 UTSW 5 106892772 missense possibly damaging 0.61
R5459:Hfm1 UTSW 5 106904763 missense probably damaging 1.00
R5485:Hfm1 UTSW 5 106847662 critical splice donor site probably null
R5585:Hfm1 UTSW 5 106911439 missense probably benign 0.05
R5631:Hfm1 UTSW 5 106904763 missense probably damaging 1.00
R5705:Hfm1 UTSW 5 106911453 missense probably benign 0.21
R5804:Hfm1 UTSW 5 106878589 splice site probably null
R5959:Hfm1 UTSW 5 106874917 missense probably damaging 1.00
R6046:Hfm1 UTSW 5 106898643 splice site probably null
R6191:Hfm1 UTSW 5 106886553 missense possibly damaging 0.95
R6345:Hfm1 UTSW 5 106841638 missense probably benign
R6580:Hfm1 UTSW 5 106847709 missense probably benign 0.00
R6651:Hfm1 UTSW 5 106847687 missense probably benign 0.00
R6761:Hfm1 UTSW 5 106895279 missense probably damaging 1.00
R6835:Hfm1 UTSW 5 106878815 nonsense probably null
R6891:Hfm1 UTSW 5 106917374 missense possibly damaging 0.49
R6924:Hfm1 UTSW 5 106850410 splice site probably null
R6980:Hfm1 UTSW 5 106880477 missense probably benign 0.31
R7054:Hfm1 UTSW 5 106896043 missense probably benign 0.01
R7058:Hfm1 UTSW 5 106911440 missense probably benign 0.04
R7189:Hfm1 UTSW 5 106901703 critical splice donor site probably null
R7250:Hfm1 UTSW 5 106904331 missense probably benign 0.00
R7376:Hfm1 UTSW 5 106895218 missense possibly damaging 0.95
R7577:Hfm1 UTSW 5 106896043 missense probably benign 0.01
R7636:Hfm1 UTSW 5 106917466 missense probably benign 0.02
R7639:Hfm1 UTSW 5 106889925 missense probably benign 0.03
R7639:Hfm1 UTSW 5 106898475 missense possibly damaging 0.46
R7763:Hfm1 UTSW 5 106881861 missense probably damaging 1.00
R7828:Hfm1 UTSW 5 106881791 critical splice donor site probably null
R7905:Hfm1 UTSW 5 106898553 missense probably damaging 1.00
R8160:Hfm1 UTSW 5 106896033 missense probably null 0.00
R8477:Hfm1 UTSW 5 106881818 missense probably benign 0.01
Z1177:Hfm1 UTSW 5 106871820 missense probably benign
Predicted Primers PCR Primer
(F):5'- CGCTGTACTCTTCAAACACACCTCC -3'
(R):5'- GCCTAGTCAAGCCCTGTGCC -3'

Sequencing Primer
(F):5'- cacccgactgctcttcc -3'
(R):5'- CATGGAGCCACACATCCAG -3'
Posted On2014-05-14