Incidental Mutation 'R1710:Fbxw13'
ID 190453
Institutional Source Beutler Lab
Gene Symbol Fbxw13
Ensembl Gene ENSMUSG00000049314
Gene Name F-box and WD-40 domain protein 13
MMRRC Submission 039743-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock # R1710 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 109179227-109195975 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 109181518 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 351 (V351I)
Ref Sequence ENSEMBL: ENSMUSP00000053786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061456] [ENSMUST00000199102] [ENSMUST00000199118]
AlphaFold Q8BI57
Predicted Effect probably damaging
Transcript: ENSMUST00000061456
AA Change: V351I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000053786
Gene: ENSMUSG00000049314
AA Change: V351I

FBOX 5 45 9.33e-5 SMART
SCOP:d1gxra_ 128 249 8e-7 SMART
Blast:WD40 137 176 2e-7 BLAST
low complexity region 421 432 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199102
SMART Domains Protein: ENSMUSP00000142352
Gene: ENSMUSG00000049314

SCOP:d1gxra_ 45 166 1e-7 SMART
Blast:WD40 54 93 7e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000199118
SMART Domains Protein: ENSMUSP00000143174
Gene: ENSMUSG00000049314

FBOX 5 45 3.25e-4 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 98% (117/120)
Allele List at MGI
Other mutations in this stock
Total: 114 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik A T 18: 70,468,063 S249R possibly damaging Het
9130409I23Rik A G 1: 181,051,319 M1V probably null Het
Acadvl T A 11: 70,010,355 I638F probably damaging Het
Acnat2 T A 4: 49,380,587 T264S probably benign Het
Acrv1 C T 9: 36,694,255 Q33* probably null Het
Actrt3 T A 3: 30,599,752 N33I probably damaging Het
Alyref2 T C 1: 171,503,600 probably benign Het
Ank2 C A 3: 126,933,060 E3712* probably null Het
Ano7 C A 1: 93,385,624 H161Q probably benign Het
Arhgap10 C A 8: 77,358,587 E451* probably null Het
Arhgap29 T A 3: 122,008,080 Y748N probably damaging Het
Arhgap45 C T 10: 80,018,098 Q149* probably null Het
Asap2 C T 12: 21,224,392 H371Y probably damaging Het
Atp6v1b1 T C 6: 83,758,390 I480T probably benign Het
BC034090 T C 1: 155,225,864 D218G possibly damaging Het
Brdt A T 5: 107,343,584 D74V probably damaging Het
C4b A G 17: 34,743,664 probably benign Het
Card11 T A 5: 140,902,905 K233* probably null Het
Catip T G 1: 74,362,770 F35V possibly damaging Het
Ccdc13 C T 9: 121,819,581 G247R probably damaging Het
Cep97 T A 16: 55,915,022 D471V probably damaging Het
Col17a1 A T 19: 47,670,931 L403Q probably damaging Het
Crbn A G 6: 106,790,945 S194P possibly damaging Het
Dhx58 T A 11: 100,703,574 H97L probably benign Het
Dnah8 T C 17: 30,854,940 I4528T probably damaging Het
Dpyd A G 3: 118,610,443 probably null Het
Entpd1 A T 19: 40,726,236 Q263L probably benign Het
Esyt3 T C 9: 99,336,191 I130M probably benign Het
Etv1 T C 12: 38,852,262 F264S probably benign Het
Fam189a2 A T 19: 23,979,695 I317N probably damaging Het
Fam196b T A 11: 34,404,263 probably null Het
Fam45a A G 19: 60,817,583 Y102C probably damaging Het
Fat1 T C 8: 45,010,482 S1354P probably benign Het
Fat4 C A 3: 38,951,155 T1901N probably damaging Het
Fmo3 A G 1: 162,967,787 F160L possibly damaging Het
Fyb2 T A 4: 105,003,916 D592E probably damaging Het
Gjb4 T C 4: 127,351,870 M93V possibly damaging Het
Gm5089 C A 14: 122,436,154 G52* probably null Het
Gm6401 G T 14: 41,966,883 N76K probably benign Het
Gm6871 A G 7: 41,546,477 S279P probably damaging Het
Gtf2ird2 T G 5: 134,211,240 V301G probably benign Het
H2bfm A C X: 136,927,467 D35A unknown Het
Hfm1 A G 5: 106,880,514 F817L probably damaging Het
Hfm1 T C 5: 106,896,003 E589G probably damaging Het
Hivep2 A T 10: 14,129,505 K616* probably null Het
Hmcn1 A T 1: 150,675,984 I2623N probably damaging Het
Igf2bp3 G T 6: 49,105,631 A339E probably damaging Het
Irx4 T C 13: 73,267,638 I182T possibly damaging Het
Jcad T C 18: 4,674,511 S758P probably damaging Het
Klhdc4 A T 8: 121,799,487 Y304* probably null Het
Lama1 A G 17: 67,753,791 I705V probably benign Het
Mbd5 A G 2: 49,257,032 N418S probably benign Het
Mmp21 C T 7: 133,677,285 V279I probably damaging Het
Morc4 A C X: 139,854,530 C272W probably damaging Het
Mrm1 A T 11: 84,818,692 C180S probably damaging Het
Ncor1 T C 11: 62,423,005 D103G probably damaging Het
Ndrg4 A G 8: 95,710,686 D251G probably damaging Het
Ndufaf5 T C 2: 140,193,602 V246A possibly damaging Het
Noa1 T C 5: 77,309,725 E111G possibly damaging Het
Nod1 C A 6: 54,944,059 V425F probably damaging Het
Nos1 A T 5: 117,895,919 I369F probably damaging Het
Nsun5 C T 5: 135,371,316 H98Y probably damaging Het
Olfr1013 C T 2: 85,769,855 T18I probably benign Het
Olfr172 A G 16: 58,761,141 F12L probably benign Het
Olfr292 G A 7: 86,695,110 R218H probably benign Het
Olfr726 C G 14: 50,084,370 V104L probably benign Het
Olfr933 A G 9: 38,975,906 I77V probably damaging Het
Olfr945 T C 9: 39,258,571 I37V probably benign Het
Optn G A 2: 5,053,130 T76I possibly damaging Het
Oscar C T 7: 3,611,856 W22* probably null Het
Palmd T A 3: 116,923,657 Y397F probably damaging Het
Plk1 A G 7: 122,168,898 D447G probably damaging Het
Plscr5 T A 9: 92,205,528 N183K probably damaging Het
Polk T G 13: 96,489,204 D364A probably damaging Het
Polr3d T C 14: 70,443,010 T36A probably benign Het
Ppp1r10 A T 17: 35,926,536 R199S probably damaging Het
Prkcz C T 4: 155,262,512 D388N probably damaging Het
Prrc2b T C 2: 32,212,222 L769P probably damaging Het
Psg26 A G 7: 18,480,041 V232A probably damaging Het
Pth2r T C 1: 65,336,838 V85A possibly damaging Het
Rbpms2 T C 9: 65,659,212 probably benign Het
Reps1 A T 10: 18,118,950 D514V possibly damaging Het
Riok3 G T 18: 12,142,961 R238L probably benign Het
Rnf19a T C 15: 36,244,207 Q569R probably damaging Het
Rorb G A 19: 18,960,501 T267I probably damaging Het
Rrm2b A T 15: 37,929,096 M70K probably damaging Het
Rsf1 A T 7: 97,662,349 E762V possibly damaging Het
S100a2 G A 3: 90,591,392 V67I probably benign Het
Skp1a T A 11: 52,242,615 D42E probably benign Het
Slc22a4 A T 11: 54,027,975 M1K probably null Het
Slc2a9 T A 5: 38,382,044 Q371L probably damaging Het
Slc4a9 A G 18: 36,532,022 T475A probably benign Het
Slc8b1 A G 5: 120,519,652 N60S probably damaging Het
Slx4 A C 16: 3,999,158 D66E probably benign Het
Smg8 A T 11: 87,086,287 I156N probably damaging Het
Snx25 A T 8: 46,116,207 C218S possibly damaging Het
Sulf2 T C 2: 166,079,072 I784V probably benign Het
Tatdn2 G T 6: 113,697,927 R72L possibly damaging Het
Tbc1d8 T C 1: 39,406,837 D91G possibly damaging Het
Tifab C A 13: 56,176,620 R3S probably benign Het
Tm4sf1 A T 3: 57,292,883 S104T probably damaging Het
Tmem132e T A 11: 82,443,517 I618N probably damaging Het
Ttc7b A T 12: 100,403,408 D367E probably damaging Het
Txlnb A G 10: 17,843,455 D678G possibly damaging Het
Vgll4 A G 6: 114,957,934 probably null Het
Vmn2r124 A T 17: 18,061,925 probably benign Het
Vmn2r2 T C 3: 64,117,399 D587G probably benign Het
Vmn2r84 G A 10: 130,391,099 A290V probably benign Het
Vps13c T A 9: 67,911,529 S1077R probably benign Het
Vsig10 C T 5: 117,351,654 A495V probably benign Het
Vwa3a A T 7: 120,804,031 probably null Het
Zfhx2 C A 14: 55,065,998 A1510S possibly damaging Het
Zfp142 T A 1: 74,572,230 D601V probably damaging Het
Zfp62 T C 11: 49,217,683 I867T probably benign Het
Other mutations in Fbxw13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02033:Fbxw13 APN 9 109181416 missense probably damaging 0.99
IGL02455:Fbxw13 APN 9 109183187 missense probably benign 0.26
IGL03154:Fbxw13 APN 9 109181465 missense probably damaging 0.96
R0304:Fbxw13 UTSW 9 109194721 missense probably benign 0.02
R1259:Fbxw13 UTSW 9 109185371 missense probably damaging 1.00
R1912:Fbxw13 UTSW 9 109181543 missense probably benign 0.10
R2877:Fbxw13 UTSW 9 109181466 missense probably damaging 1.00
R2878:Fbxw13 UTSW 9 109181466 missense probably damaging 1.00
R3085:Fbxw13 UTSW 9 109184231 nonsense probably null
R4321:Fbxw13 UTSW 9 109181435 missense probably benign 0.10
R4969:Fbxw13 UTSW 9 109181524 splice site probably null
R5024:Fbxw13 UTSW 9 109179335 missense probably benign 0.00
R5450:Fbxw13 UTSW 9 109184157 missense probably benign 0.41
R5957:Fbxw13 UTSW 9 109192666 critical splice donor site probably null
R6801:Fbxw13 UTSW 9 109194727 missense probably null 1.00
R7448:Fbxw13 UTSW 9 109185403 missense unknown
R7710:Fbxw13 UTSW 9 109195900 missense probably damaging 1.00
R8163:Fbxw13 UTSW 9 109183054 missense probably benign 0.45
R8320:Fbxw13 UTSW 9 109183066 missense probably benign 0.02
R8714:Fbxw13 UTSW 9 109194764 missense probably benign 0.00
R8845:Fbxw13 UTSW 9 109194765 missense possibly damaging 0.85
R8884:Fbxw13 UTSW 9 109181401 missense probably benign 0.00
R8979:Fbxw13 UTSW 9 109184129 missense probably damaging 0.96
R9223:Fbxw13 UTSW 9 109195048 missense probably damaging 1.00
R9318:Fbxw13 UTSW 9 109179314 missense probably benign 0.17
X0065:Fbxw13 UTSW 9 109192708 missense probably damaging 0.96
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- tgtaaaggtggaaagagagagac -3'
Posted On 2014-05-14