Incidental Mutation 'R1710:Arhgap45'
ID190459
Institutional Source Beutler Lab
Gene Symbol Arhgap45
Ensembl Gene ENSMUSG00000035697
Gene NameRho GTPase activating protein 45
Synonyms6330406L22Rik, Hmha1
MMRRC Submission 039743-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1710 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location80016653-80031472 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 80018098 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 149 (Q149*)
Ref Sequence ENSEMBL: ENSMUSP00000101012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043311] [ENSMUST00000043866] [ENSMUST00000099501] [ENSMUST00000105373] [ENSMUST00000132517] [ENSMUST00000171637]
Predicted Effect probably benign
Transcript: ENSMUST00000043311
SMART Domains Protein: ENSMUSP00000041019
Gene: ENSMUSG00000035697

DomainStartEndE-ValueType
low complexity region 142 153 N/A INTRINSIC
FCH 157 244 4.14e-17 SMART
low complexity region 255 269 N/A INTRINSIC
low complexity region 309 324 N/A INTRINSIC
low complexity region 330 345 N/A INTRINSIC
low complexity region 527 536 N/A INTRINSIC
C1 582 628 3.15e-8 SMART
RhoGAP 653 852 2.73e-73 SMART
low complexity region 856 869 N/A INTRINSIC
Blast:RhoGAP 876 999 1e-21 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000043866
SMART Domains Protein: ENSMUSP00000043090
Gene: ENSMUSG00000035722

DomainStartEndE-ValueType
transmembrane domain 23 42 N/A INTRINSIC
Pfam:ABC2_membrane_3 515 747 1.1e-17 PFAM
AAA 830 1011 4.97e-12 SMART
low complexity region 1136 1147 N/A INTRINSIC
transmembrane domain 1241 1263 N/A INTRINSIC
low complexity region 1299 1309 N/A INTRINSIC
low complexity region 1374 1390 N/A INTRINSIC
Pfam:ABC2_membrane_3 1427 1764 9e-43 PFAM
AAA 1833 2018 7.2e-9 SMART
low complexity region 2120 2135 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000099501
AA Change: Q138*
SMART Domains Protein: ENSMUSP00000097100
Gene: ENSMUSG00000035697
AA Change: Q138*

DomainStartEndE-ValueType
low complexity region 258 269 N/A INTRINSIC
FCH 273 360 4.14e-17 SMART
low complexity region 371 385 N/A INTRINSIC
low complexity region 425 440 N/A INTRINSIC
low complexity region 446 461 N/A INTRINSIC
low complexity region 643 652 N/A INTRINSIC
C1 698 744 3.15e-8 SMART
RhoGAP 769 968 2.73e-73 SMART
low complexity region 972 985 N/A INTRINSIC
Blast:RhoGAP 992 1115 1e-21 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000105373
AA Change: Q149*
SMART Domains Protein: ENSMUSP00000101012
Gene: ENSMUSG00000035697
AA Change: Q149*

DomainStartEndE-ValueType
low complexity region 269 280 N/A INTRINSIC
FCH 284 371 4.14e-17 SMART
low complexity region 382 396 N/A INTRINSIC
low complexity region 436 451 N/A INTRINSIC
low complexity region 457 472 N/A INTRINSIC
low complexity region 654 663 N/A INTRINSIC
C1 709 755 3.15e-8 SMART
RhoGAP 780 979 2.73e-73 SMART
low complexity region 983 996 N/A INTRINSIC
Blast:RhoGAP 1003 1126 1e-21 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000132517
SMART Domains Protein: ENSMUSP00000115111
Gene: ENSMUSG00000035722

DomainStartEndE-ValueType
transmembrane domain 23 42 N/A INTRINSIC
Pfam:ABC2_membrane_3 515 747 1.1e-17 PFAM
AAA 830 1011 4.97e-12 SMART
low complexity region 1136 1147 N/A INTRINSIC
transmembrane domain 1241 1263 N/A INTRINSIC
low complexity region 1299 1309 N/A INTRINSIC
low complexity region 1374 1390 N/A INTRINSIC
Pfam:ABC2_membrane_3 1427 1764 9e-43 PFAM
AAA 1833 2018 7.2e-9 SMART
low complexity region 2120 2135 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140974
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150022
Predicted Effect probably benign
Transcript: ENSMUST00000171637
SMART Domains Protein: ENSMUSP00000128121
Gene: ENSMUSG00000035722

DomainStartEndE-ValueType
transmembrane domain 23 42 N/A INTRINSIC
Pfam:ABC2_membrane_3 517 747 2.8e-19 PFAM
AAA 830 1011 4.97e-12 SMART
low complexity region 1136 1147 N/A INTRINSIC
transmembrane domain 1249 1271 N/A INTRINSIC
low complexity region 1307 1317 N/A INTRINSIC
low complexity region 1382 1398 N/A INTRINSIC
Pfam:ABC2_membrane_3 1426 1772 3.9e-47 PFAM
AAA 1841 2026 7.2e-9 SMART
low complexity region 2128 2143 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 98% (117/120)
Allele List at MGI
Other mutations in this stock
Total: 114 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik A T 18: 70,468,063 S249R possibly damaging Het
9130409I23Rik A G 1: 181,051,319 M1V probably null Het
Acadvl T A 11: 70,010,355 I638F probably damaging Het
Acnat2 T A 4: 49,380,587 T264S probably benign Het
Acrv1 C T 9: 36,694,255 Q33* probably null Het
Actrt3 T A 3: 30,599,752 N33I probably damaging Het
Alyref2 T C 1: 171,503,600 probably benign Het
Ank2 C A 3: 126,933,060 E3712* probably null Het
Ano7 C A 1: 93,385,624 H161Q probably benign Het
Arhgap10 C A 8: 77,358,587 E451* probably null Het
Arhgap29 T A 3: 122,008,080 Y748N probably damaging Het
Asap2 C T 12: 21,224,392 H371Y probably damaging Het
Atp6v1b1 T C 6: 83,758,390 I480T probably benign Het
BC034090 T C 1: 155,225,864 D218G possibly damaging Het
Brdt A T 5: 107,343,584 D74V probably damaging Het
C4b A G 17: 34,743,664 probably benign Het
Card11 T A 5: 140,902,905 K233* probably null Het
Catip T G 1: 74,362,770 F35V possibly damaging Het
Ccdc13 C T 9: 121,819,581 G247R probably damaging Het
Cep97 T A 16: 55,915,022 D471V probably damaging Het
Col17a1 A T 19: 47,670,931 L403Q probably damaging Het
Crbn A G 6: 106,790,945 S194P possibly damaging Het
Dhx58 T A 11: 100,703,574 H97L probably benign Het
Dnah8 T C 17: 30,854,940 I4528T probably damaging Het
Dpyd A G 3: 118,610,443 probably null Het
Entpd1 A T 19: 40,726,236 Q263L probably benign Het
Esyt3 T C 9: 99,336,191 I130M probably benign Het
Etv1 T C 12: 38,852,262 F264S probably benign Het
Fam189a2 A T 19: 23,979,695 I317N probably damaging Het
Fam196b T A 11: 34,404,263 probably null Het
Fam45a A G 19: 60,817,583 Y102C probably damaging Het
Fat1 T C 8: 45,010,482 S1354P probably benign Het
Fat4 C A 3: 38,951,155 T1901N probably damaging Het
Fbxw13 C T 9: 109,181,518 V351I probably damaging Het
Fmo3 A G 1: 162,967,787 F160L possibly damaging Het
Fyb2 T A 4: 105,003,916 D592E probably damaging Het
Gjb4 T C 4: 127,351,870 M93V possibly damaging Het
Gm5089 C A 14: 122,436,154 G52* probably null Het
Gm6401 G T 14: 41,966,883 N76K probably benign Het
Gm6871 A G 7: 41,546,477 S279P probably damaging Het
Gtf2ird2 T G 5: 134,211,240 V301G probably benign Het
H2bfm A C X: 136,927,467 D35A unknown Het
Hfm1 A G 5: 106,880,514 F817L probably damaging Het
Hfm1 T C 5: 106,896,003 E589G probably damaging Het
Hivep2 A T 10: 14,129,505 K616* probably null Het
Hmcn1 A T 1: 150,675,984 I2623N probably damaging Het
Igf2bp3 G T 6: 49,105,631 A339E probably damaging Het
Irx4 T C 13: 73,267,638 I182T possibly damaging Het
Jcad T C 18: 4,674,511 S758P probably damaging Het
Klhdc4 A T 8: 121,799,487 Y304* probably null Het
Lama1 A G 17: 67,753,791 I705V probably benign Het
Mbd5 A G 2: 49,257,032 N418S probably benign Het
Mmp21 C T 7: 133,677,285 V279I probably damaging Het
Morc4 A C X: 139,854,530 C272W probably damaging Het
Mrm1 A T 11: 84,818,692 C180S probably damaging Het
Ncor1 T C 11: 62,423,005 D103G probably damaging Het
Ndrg4 A G 8: 95,710,686 D251G probably damaging Het
Ndufaf5 T C 2: 140,193,602 V246A possibly damaging Het
Noa1 T C 5: 77,309,725 E111G possibly damaging Het
Nod1 C A 6: 54,944,059 V425F probably damaging Het
Nos1 A T 5: 117,895,919 I369F probably damaging Het
Nsun5 C T 5: 135,371,316 H98Y probably damaging Het
Olfr1013 C T 2: 85,769,855 T18I probably benign Het
Olfr172 A G 16: 58,761,141 F12L probably benign Het
Olfr292 G A 7: 86,695,110 R218H probably benign Het
Olfr726 C G 14: 50,084,370 V104L probably benign Het
Olfr933 A G 9: 38,975,906 I77V probably damaging Het
Olfr945 T C 9: 39,258,571 I37V probably benign Het
Optn G A 2: 5,053,130 T76I possibly damaging Het
Oscar C T 7: 3,611,856 W22* probably null Het
Palmd T A 3: 116,923,657 Y397F probably damaging Het
Plk1 A G 7: 122,168,898 D447G probably damaging Het
Plscr5 T A 9: 92,205,528 N183K probably damaging Het
Polk T G 13: 96,489,204 D364A probably damaging Het
Polr3d T C 14: 70,443,010 T36A probably benign Het
Ppp1r10 A T 17: 35,926,536 R199S probably damaging Het
Prkcz C T 4: 155,262,512 D388N probably damaging Het
Prrc2b T C 2: 32,212,222 L769P probably damaging Het
Psg26 A G 7: 18,480,041 V232A probably damaging Het
Pth2r T C 1: 65,336,838 V85A possibly damaging Het
Rbpms2 T C 9: 65,659,212 probably benign Het
Reps1 A T 10: 18,118,950 D514V possibly damaging Het
Riok3 G T 18: 12,142,961 R238L probably benign Het
Rnf19a T C 15: 36,244,207 Q569R probably damaging Het
Rorb G A 19: 18,960,501 T267I probably damaging Het
Rrm2b A T 15: 37,929,096 M70K probably damaging Het
Rsf1 A T 7: 97,662,349 E762V possibly damaging Het
S100a2 G A 3: 90,591,392 V67I probably benign Het
Skp1a T A 11: 52,242,615 D42E probably benign Het
Slc22a4 A T 11: 54,027,975 M1K probably null Het
Slc2a9 T A 5: 38,382,044 Q371L probably damaging Het
Slc4a9 A G 18: 36,532,022 T475A probably benign Het
Slc8b1 A G 5: 120,519,652 N60S probably damaging Het
Slx4 A C 16: 3,999,158 D66E probably benign Het
Smg8 A T 11: 87,086,287 I156N probably damaging Het
Snx25 A T 8: 46,116,207 C218S possibly damaging Het
Sulf2 T C 2: 166,079,072 I784V probably benign Het
Tatdn2 G T 6: 113,697,927 R72L possibly damaging Het
Tbc1d8 T C 1: 39,406,837 D91G possibly damaging Het
Tifab C A 13: 56,176,620 R3S probably benign Het
Tm4sf1 A T 3: 57,292,883 S104T probably damaging Het
Tmem132e T A 11: 82,443,517 I618N probably damaging Het
Ttc7b A T 12: 100,403,408 D367E probably damaging Het
Txlnb A G 10: 17,843,455 D678G possibly damaging Het
Vgll4 A G 6: 114,957,934 probably null Het
Vmn2r124 A T 17: 18,061,925 probably benign Het
Vmn2r2 T C 3: 64,117,399 D587G probably benign Het
Vmn2r84 G A 10: 130,391,099 A290V probably benign Het
Vps13c T A 9: 67,911,529 S1077R probably benign Het
Vsig10 C T 5: 117,351,654 A495V probably benign Het
Vwa3a A T 7: 120,804,031 probably null Het
Zfhx2 C A 14: 55,065,998 A1510S possibly damaging Het
Zfp142 T A 1: 74,572,230 D601V probably damaging Het
Zfp62 T C 11: 49,217,683 I867T probably benign Het
Other mutations in Arhgap45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01360:Arhgap45 APN 10 80028648 splice site probably benign
IGL01414:Arhgap45 APN 10 80027104 missense probably damaging 1.00
IGL01505:Arhgap45 APN 10 80026542 missense probably benign 0.10
IGL02203:Arhgap45 APN 10 80027553 nonsense probably null
IGL02557:Arhgap45 APN 10 80021638 missense probably damaging 1.00
IGL02858:Arhgap45 APN 10 80017934 missense probably benign 0.20
IGL03292:Arhgap45 APN 10 80020969 missense probably benign 0.04
IGL03352:Arhgap45 APN 10 80030751 missense probably damaging 0.96
Celt UTSW 10 80020818 missense probably damaging 1.00
celtic UTSW 10 80027589 nonsense probably null
druid UTSW 10 80026347 critical splice donor site probably null
Mistletoe UTSW 10 80027102 nonsense probably null
Roman UTSW 10 80027597 missense probably damaging 1.00
stonehenge UTSW 10 80025482 missense possibly damaging 0.81
IGL03048:Arhgap45 UTSW 10 80017017 missense probably damaging 0.99
PIT4677001:Arhgap45 UTSW 10 80020749 missense probably benign
R0532:Arhgap45 UTSW 10 80022083 missense possibly damaging 0.92
R1233:Arhgap45 UTSW 10 80027582 missense probably damaging 1.00
R1579:Arhgap45 UTSW 10 80028977 missense probably damaging 1.00
R1666:Arhgap45 UTSW 10 80028750 missense possibly damaging 0.82
R1668:Arhgap45 UTSW 10 80028750 missense possibly damaging 0.82
R1688:Arhgap45 UTSW 10 80029095 missense probably damaging 1.00
R1902:Arhgap45 UTSW 10 80025466 missense probably damaging 0.99
R1912:Arhgap45 UTSW 10 80020690 missense probably benign 0.08
R1935:Arhgap45 UTSW 10 80030954 missense probably damaging 1.00
R1936:Arhgap45 UTSW 10 80030954 missense probably damaging 1.00
R1955:Arhgap45 UTSW 10 80026492 missense probably benign 0.15
R1968:Arhgap45 UTSW 10 80027702 missense probably damaging 1.00
R1977:Arhgap45 UTSW 10 80020818 missense probably damaging 1.00
R1986:Arhgap45 UTSW 10 80020696 missense probably damaging 1.00
R2074:Arhgap45 UTSW 10 80027180 missense probably damaging 1.00
R2081:Arhgap45 UTSW 10 80027674 missense probably damaging 1.00
R2162:Arhgap45 UTSW 10 80016979 start codon destroyed probably null 0.02
R2937:Arhgap45 UTSW 10 80029002 missense probably damaging 1.00
R2938:Arhgap45 UTSW 10 80029002 missense probably damaging 1.00
R3081:Arhgap45 UTSW 10 80026447 missense probably damaging 1.00
R4695:Arhgap45 UTSW 10 80025530 missense probably damaging 1.00
R4736:Arhgap45 UTSW 10 80026172 missense probably damaging 1.00
R4758:Arhgap45 UTSW 10 80030293 missense probably benign 0.00
R4860:Arhgap45 UTSW 10 80027066 missense probably damaging 1.00
R4860:Arhgap45 UTSW 10 80027066 missense probably damaging 1.00
R4934:Arhgap45 UTSW 10 80020957 missense probably damaging 1.00
R4943:Arhgap45 UTSW 10 80026503 missense probably benign 0.00
R5102:Arhgap45 UTSW 10 80021428 missense probably benign 0.01
R5128:Arhgap45 UTSW 10 80030959 missense probably benign 0.16
R5667:Arhgap45 UTSW 10 80025476 missense probably damaging 1.00
R5671:Arhgap45 UTSW 10 80025476 missense probably damaging 1.00
R5920:Arhgap45 UTSW 10 80029131 missense possibly damaging 0.87
R5998:Arhgap45 UTSW 10 80030950 missense probably damaging 0.99
R6276:Arhgap45 UTSW 10 80026234 missense probably benign 0.25
R6675:Arhgap45 UTSW 10 80018104 missense probably null 0.98
R6738:Arhgap45 UTSW 10 80027597 missense probably damaging 1.00
R6783:Arhgap45 UTSW 10 80017864 missense possibly damaging 0.92
R6863:Arhgap45 UTSW 10 80017782 missense probably benign 0.03
R6978:Arhgap45 UTSW 10 80021848 missense probably benign 0.00
R7089:Arhgap45 UTSW 10 80026347 critical splice donor site probably null
R7215:Arhgap45 UTSW 10 80025482 missense possibly damaging 0.81
R7307:Arhgap45 UTSW 10 80029182 missense probably benign 0.14
R7308:Arhgap45 UTSW 10 80026558 critical splice donor site probably null
R7480:Arhgap45 UTSW 10 80027102 nonsense probably null
R7481:Arhgap45 UTSW 10 80022300 missense possibly damaging 0.80
R7649:Arhgap45 UTSW 10 80031001 missense probably benign 0.00
R7652:Arhgap45 UTSW 10 80028838 missense probably benign 0.01
R7748:Arhgap45 UTSW 10 80016932 unclassified probably benign
R7883:Arhgap45 UTSW 10 80027589 nonsense probably null
R8121:Arhgap45 UTSW 10 80018075 missense probably damaging 0.99
X0023:Arhgap45 UTSW 10 80030800 missense probably damaging 0.98
X0063:Arhgap45 UTSW 10 80030356 missense possibly damaging 0.51
Z1176:Arhgap45 UTSW 10 80025536 missense probably damaging 1.00
Z1176:Arhgap45 UTSW 10 80029052 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCCAGTGCAGCAGGCTTCC -3'
(R):5'- TGTAGGACCAGGCACGCCAG -3'

Sequencing Primer
(F):5'- CAGCAGGCTTCCCGCTC -3'
(R):5'- cttctctctctctctctctttctc -3'
Posted On2014-05-14