Incidental Mutation 'R1710:Rnf19a'
ID 190485
Institutional Source Beutler Lab
Gene Symbol Rnf19a
Ensembl Gene ENSMUSG00000022280
Gene Name ring finger protein 19A
Synonyms XY body protein, Rnf19, Dorfin, XYbp
MMRRC Submission 039743-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.572) question?
Stock # R1710 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 36240080-36283293 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 36244353 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Arginine at position 569 (Q569R)
Ref Sequence ENSEMBL: ENSMUSP00000022890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022890] [ENSMUST00000228358]
AlphaFold P50636
Predicted Effect probably damaging
Transcript: ENSMUST00000022890
AA Change: Q569R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022890
Gene: ENSMUSG00000022280
AA Change: Q569R

DomainStartEndE-ValueType
low complexity region 40 56 N/A INTRINSIC
low complexity region 72 82 N/A INTRINSIC
RING 132 179 5.56e-3 SMART
IBR 199 264 1.5e-24 SMART
IBR 283 347 1.87e-2 SMART
transmembrane domain 373 395 N/A INTRINSIC
transmembrane domain 416 438 N/A INTRINSIC
low complexity region 502 520 N/A INTRINSIC
low complexity region 664 682 N/A INTRINSIC
low complexity region 723 734 N/A INTRINSIC
low complexity region 775 787 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185150
Predicted Effect probably benign
Transcript: ENSMUST00000228358
Meta Mutation Damage Score 0.0910 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 98% (117/120)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ring between ring fingers (RBR) protein family, and the encoded protein contains two RING-finger motifs and an in between RING fingers motif. This protein is an E3 ubiquitin ligase that is localized to Lewy bodies, and ubiquitylates synphilin-1, which is an interacting protein of alpha synuclein in neurons. The encoded protein may be involved in amyotrophic lateral sclerosis and Parkinson's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 114 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik A T 18: 70,601,134 (GRCm39) S249R possibly damaging Het
Acadvl T A 11: 69,901,181 (GRCm39) I638F probably damaging Het
Acnat2 T A 4: 49,380,587 (GRCm39) T264S probably benign Het
Acrv1 C T 9: 36,605,551 (GRCm39) Q33* probably null Het
Actrt3 T A 3: 30,653,901 (GRCm39) N33I probably damaging Het
Alyref2 T C 1: 171,331,168 (GRCm39) probably benign Het
Ank2 C A 3: 126,726,709 (GRCm39) E3712* probably null Het
Ano7 C A 1: 93,313,346 (GRCm39) H161Q probably benign Het
Arhgap10 C A 8: 78,085,216 (GRCm39) E451* probably null Het
Arhgap29 T A 3: 121,801,729 (GRCm39) Y748N probably damaging Het
Arhgap45 C T 10: 79,853,932 (GRCm39) Q149* probably null Het
Asap2 C T 12: 21,274,393 (GRCm39) H371Y probably damaging Het
Atp6v1b1 T C 6: 83,735,372 (GRCm39) I480T probably benign Het
BC034090 T C 1: 155,101,610 (GRCm39) D218G possibly damaging Het
Brdt A T 5: 107,491,450 (GRCm39) D74V probably damaging Het
C4b A G 17: 34,962,638 (GRCm39) probably benign Het
Card11 T A 5: 140,888,660 (GRCm39) K233* probably null Het
Catip T G 1: 74,401,929 (GRCm39) F35V possibly damaging Het
Ccdc13 C T 9: 121,648,647 (GRCm39) G247R probably damaging Het
Cep97 T A 16: 55,735,385 (GRCm39) D471V probably damaging Het
Col17a1 A T 19: 47,659,370 (GRCm39) L403Q probably damaging Het
Crbn A G 6: 106,767,906 (GRCm39) S194P possibly damaging Het
Degs1l A G 1: 180,878,884 (GRCm39) M1V probably null Het
Dennd10 A G 19: 60,806,021 (GRCm39) Y102C probably damaging Het
Dhx58 T A 11: 100,594,400 (GRCm39) H97L probably benign Het
Dnah8 T C 17: 31,073,914 (GRCm39) I4528T probably damaging Het
Dpyd A G 3: 118,404,092 (GRCm39) probably null Het
Entpd1 A T 19: 40,714,680 (GRCm39) Q263L probably benign Het
Entrep1 A T 19: 23,957,059 (GRCm39) I317N probably damaging Het
Esyt3 T C 9: 99,218,244 (GRCm39) I130M probably benign Het
Etv1 T C 12: 38,902,261 (GRCm39) F264S probably benign Het
Fat1 T C 8: 45,463,519 (GRCm39) S1354P probably benign Het
Fat4 C A 3: 39,005,304 (GRCm39) T1901N probably damaging Het
Fbxw13 C T 9: 109,010,586 (GRCm39) V351I probably damaging Het
Fmo3 A G 1: 162,795,356 (GRCm39) F160L possibly damaging Het
Fyb2 T A 4: 104,861,113 (GRCm39) D592E probably damaging Het
Gjb4 T C 4: 127,245,663 (GRCm39) M93V possibly damaging Het
Gm5089 C A 14: 122,673,566 (GRCm39) G52* probably null Het
Gm6401 G T 14: 41,788,840 (GRCm39) N76K probably benign Het
Gm6871 A G 7: 41,195,901 (GRCm39) S279P probably damaging Het
Gtf2ird2 T G 5: 134,240,081 (GRCm39) V301G probably benign Het
H2bw2 A C X: 135,828,216 (GRCm39) D35A unknown Het
Hfm1 A G 5: 107,028,380 (GRCm39) F817L probably damaging Het
Hfm1 T C 5: 107,043,869 (GRCm39) E589G probably damaging Het
Hivep2 A T 10: 14,005,249 (GRCm39) K616* probably null Het
Hmcn1 A T 1: 150,551,735 (GRCm39) I2623N probably damaging Het
Igf2bp3 G T 6: 49,082,565 (GRCm39) A339E probably damaging Het
Insyn2b T A 11: 34,354,263 (GRCm39) probably null Het
Irx4 T C 13: 73,415,757 (GRCm39) I182T possibly damaging Het
Jcad T C 18: 4,674,511 (GRCm39) S758P probably damaging Het
Klhdc4 A T 8: 122,526,226 (GRCm39) Y304* probably null Het
Lama1 A G 17: 68,060,786 (GRCm39) I705V probably benign Het
Mbd5 A G 2: 49,147,044 (GRCm39) N418S probably benign Het
Mmp21 C T 7: 133,279,014 (GRCm39) V279I probably damaging Het
Morc4 A C X: 138,755,279 (GRCm39) C272W probably damaging Het
Mrm1 A T 11: 84,709,518 (GRCm39) C180S probably damaging Het
Ncor1 T C 11: 62,313,831 (GRCm39) D103G probably damaging Het
Ndrg4 A G 8: 96,437,314 (GRCm39) D251G probably damaging Het
Ndufaf5 T C 2: 140,035,522 (GRCm39) V246A possibly damaging Het
Noa1 T C 5: 77,457,572 (GRCm39) E111G possibly damaging Het
Nod1 C A 6: 54,921,044 (GRCm39) V425F probably damaging Het
Nos1 A T 5: 118,033,984 (GRCm39) I369F probably damaging Het
Nsun5 C T 5: 135,400,170 (GRCm39) H98Y probably damaging Het
Optn G A 2: 5,057,941 (GRCm39) T76I possibly damaging Het
Or14c39 G A 7: 86,344,318 (GRCm39) R218H probably benign Het
Or4k15c C G 14: 50,321,827 (GRCm39) V104L probably benign Het
Or5k1b A G 16: 58,581,504 (GRCm39) F12L probably benign Het
Or8d1b A G 9: 38,887,202 (GRCm39) I77V probably damaging Het
Or8g28 T C 9: 39,169,867 (GRCm39) I37V probably benign Het
Or9g19 C T 2: 85,600,199 (GRCm39) T18I probably benign Het
Oscar C T 7: 3,614,855 (GRCm39) W22* probably null Het
Palmd T A 3: 116,717,306 (GRCm39) Y397F probably damaging Het
Plk1 A G 7: 121,768,121 (GRCm39) D447G probably damaging Het
Plscr5 T A 9: 92,087,581 (GRCm39) N183K probably damaging Het
Polk T G 13: 96,625,712 (GRCm39) D364A probably damaging Het
Polr3d T C 14: 70,680,450 (GRCm39) T36A probably benign Het
Ppp1r10 A T 17: 36,237,428 (GRCm39) R199S probably damaging Het
Prkcz C T 4: 155,346,969 (GRCm39) D388N probably damaging Het
Prrc2b T C 2: 32,102,234 (GRCm39) L769P probably damaging Het
Psg26 A G 7: 18,213,966 (GRCm39) V232A probably damaging Het
Pth2r T C 1: 65,375,997 (GRCm39) V85A possibly damaging Het
Rbpms2 T C 9: 65,566,494 (GRCm39) probably benign Het
Reps1 A T 10: 17,994,698 (GRCm39) D514V possibly damaging Het
Riok3 G T 18: 12,276,018 (GRCm39) R238L probably benign Het
Rorb G A 19: 18,937,865 (GRCm39) T267I probably damaging Het
Rrm2b A T 15: 37,929,340 (GRCm39) M70K probably damaging Het
Rsf1 A T 7: 97,311,556 (GRCm39) E762V possibly damaging Het
S100a2 G A 3: 90,498,699 (GRCm39) V67I probably benign Het
Skp1 T A 11: 52,133,442 (GRCm39) D42E probably benign Het
Slc22a4 A T 11: 53,918,801 (GRCm39) M1K probably null Het
Slc2a9 T A 5: 38,539,387 (GRCm39) Q371L probably damaging Het
Slc4a9 A G 18: 36,665,075 (GRCm39) T475A probably benign Het
Slc8b1 A G 5: 120,657,717 (GRCm39) N60S probably damaging Het
Slx4 A C 16: 3,817,022 (GRCm39) D66E probably benign Het
Smg8 A T 11: 86,977,113 (GRCm39) I156N probably damaging Het
Snx25 A T 8: 46,569,244 (GRCm39) C218S possibly damaging Het
Sulf2 T C 2: 165,920,992 (GRCm39) I784V probably benign Het
Tatdn2 G T 6: 113,674,888 (GRCm39) R72L possibly damaging Het
Tbc1d8 T C 1: 39,445,918 (GRCm39) D91G possibly damaging Het
Tifab C A 13: 56,324,433 (GRCm39) R3S probably benign Het
Tm4sf1 A T 3: 57,200,304 (GRCm39) S104T probably damaging Het
Tmem132e T A 11: 82,334,343 (GRCm39) I618N probably damaging Het
Ttc7b A T 12: 100,369,667 (GRCm39) D367E probably damaging Het
Txlnb A G 10: 17,719,203 (GRCm39) D678G possibly damaging Het
Vgll4 A G 6: 114,934,895 (GRCm39) probably null Het
Vmn2r124 A T 17: 18,282,187 (GRCm39) probably benign Het
Vmn2r2 T C 3: 64,024,820 (GRCm39) D587G probably benign Het
Vmn2r84 G A 10: 130,226,968 (GRCm39) A290V probably benign Het
Vps13c T A 9: 67,818,811 (GRCm39) S1077R probably benign Het
Vsig10 C T 5: 117,489,719 (GRCm39) A495V probably benign Het
Vwa3a A T 7: 120,403,254 (GRCm39) probably null Het
Zfhx2 C A 14: 55,303,455 (GRCm39) A1510S possibly damaging Het
Zfp142 T A 1: 74,611,389 (GRCm39) D601V probably damaging Het
Zfp62 T C 11: 49,108,510 (GRCm39) I867T probably benign Het
Other mutations in Rnf19a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Rnf19a APN 15 36,265,948 (GRCm39) missense probably damaging 0.98
Cycle UTSW 15 36,253,450 (GRCm39) intron probably benign
Tolkien UTSW 15 36,265,452 (GRCm39) missense possibly damaging 0.80
Wagner UTSW 15 36,244,342 (GRCm39) missense probably benign 0.05
R0245:Rnf19a UTSW 15 36,253,178 (GRCm39) missense probably damaging 1.00
R0583:Rnf19a UTSW 15 36,253,151 (GRCm39) missense probably damaging 1.00
R1295:Rnf19a UTSW 15 36,244,247 (GRCm39) nonsense probably null
R1528:Rnf19a UTSW 15 36,265,801 (GRCm39) missense possibly damaging 0.75
R1835:Rnf19a UTSW 15 36,266,071 (GRCm39) missense probably benign
R2005:Rnf19a UTSW 15 36,241,916 (GRCm39) missense possibly damaging 0.52
R2110:Rnf19a UTSW 15 36,254,665 (GRCm39) missense possibly damaging 0.79
R3118:Rnf19a UTSW 15 36,242,045 (GRCm39) nonsense probably null
R3776:Rnf19a UTSW 15 36,266,058 (GRCm39) missense probably benign 0.03
R4005:Rnf19a UTSW 15 36,245,774 (GRCm39) missense probably damaging 0.98
R5184:Rnf19a UTSW 15 36,244,342 (GRCm39) missense probably benign 0.05
R5297:Rnf19a UTSW 15 36,247,924 (GRCm39) missense probably damaging 1.00
R5386:Rnf19a UTSW 15 36,242,185 (GRCm39) missense probably benign 0.01
R5647:Rnf19a UTSW 15 36,266,109 (GRCm39) start gained probably benign
R6451:Rnf19a UTSW 15 36,253,205 (GRCm39) missense possibly damaging 0.64
R7003:Rnf19a UTSW 15 36,254,650 (GRCm39) nonsense probably null
R7304:Rnf19a UTSW 15 36,254,598 (GRCm39) missense probably damaging 0.98
R7893:Rnf19a UTSW 15 36,241,814 (GRCm39) missense possibly damaging 0.95
R8808:Rnf19a UTSW 15 36,242,021 (GRCm39) missense probably benign 0.00
R8864:Rnf19a UTSW 15 36,265,452 (GRCm39) missense possibly damaging 0.80
R8940:Rnf19a UTSW 15 36,260,284 (GRCm39) missense probably damaging 1.00
R9063:Rnf19a UTSW 15 36,265,615 (GRCm39) nonsense probably null
R9093:Rnf19a UTSW 15 36,253,450 (GRCm39) intron probably benign
R9135:Rnf19a UTSW 15 36,253,310 (GRCm39) critical splice acceptor site probably null
R9525:Rnf19a UTSW 15 36,247,375 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCTTCACAGCCACACAGTTCTAC -3'
(R):5'- GGGCGGATGTTGTTCAGTATACCAC -3'

Sequencing Primer
(F):5'- AACGGAGTTCTTCCTCTGAACAG -3'
(R):5'- AACCGAAGAGTTGCAGTGTC -3'
Posted On 2014-05-14