Mutagenetix > Incidental Mutation

Incidental Mutation 'R1710:Dnah8'

190493

Institutional Source

Beutler Lab

Gene Symbol

Dnah8

Ensembl Gene

ENSMUSG00000033826

Gene Name

dynein, axonemal, heavy chain 8

Synonyms

Dnahc8, P1-Loop, Hst6.7b

MMRRC Submission

039743-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.323) question?

Stock #

R1710 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

30624354-30875264 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 30854940 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 4528 (I4528T)

Ref Sequence

ENSEMBL: ENSMUSP00000127878 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000170651]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000170651
AA Change: I4528T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000127878
Gene: ENSMUSG00000033826
AA Change: I4528T

Domain	Start	End	E-Value	Type
low complexity region	2	54	N/A	INTRINSIC
Pfam:DHC_N1	379	936	8.4e-159	PFAM
low complexity region	1069	1080	N/A	INTRINSIC
low complexity region	1224	1237	N/A	INTRINSIC
Pfam:DHC_N2	1509	1917	1.6e-134	PFAM
AAA	2082	2226	1.38e-1	SMART
AAA	2363	2516	2.04e-1	SMART
AAA	2689	2837	8.15e-2	SMART
Pfam:AAA_8	3022	3294	4e-72	PFAM
Pfam:MT	3306	3656	3.6e-48	PFAM
Pfam:AAA_9	3676	3901	6.7e-85	PFAM
Pfam:Dynein_heavy	4039	4728	8.4e-250	PFAM

Meta Mutation Damage Score

0.4151

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.5%

Validation Efficiency

98% (117/120)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a heavy chain of an axonemal dynein involved in sperm and respiratory cilia motility. Axonemal dyneins generate force through hydrolysis of ATP and binding to microtubules. [provided by RefSeq, Jan 2012]

Allele List at MGI

Other mutations in this stock

Total: 114 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930503L19Rik	A	T	18: 70,468,063	S249R	possibly damaging	Het
9130409I23Rik	A	G	1: 181,051,319	M1V	probably null	Het
Acadvl	T	A	11: 70,010,355	I638F	probably damaging	Het
Acnat2	T	A	4: 49,380,587	T264S	probably benign	Het
Acrv1	C	T	9: 36,694,255	Q33*	probably null	Het
Actrt3	T	A	3: 30,599,752	N33I	probably damaging	Het
Alyref2	T	C	1: 171,503,600		probably benign	Het
Ank2	C	A	3: 126,933,060	E3712*	probably null	Het
Ano7	C	A	1: 93,385,624	H161Q	probably benign	Het
Arhgap10	C	A	8: 77,358,587	E451*	probably null	Het
Arhgap29	T	A	3: 122,008,080	Y748N	probably damaging	Het
Arhgap45	C	T	10: 80,018,098	Q149*	probably null	Het
Asap2	C	T	12: 21,224,392	H371Y	probably damaging	Het
Atp6v1b1	T	C	6: 83,758,390	I480T	probably benign	Het
BC034090	T	C	1: 155,225,864	D218G	possibly damaging	Het
Brdt	A	T	5: 107,343,584	D74V	probably damaging	Het
C4b	A	G	17: 34,743,664		probably benign	Het
Card11	T	A	5: 140,902,905	K233*	probably null	Het
Catip	T	G	1: 74,362,770	F35V	possibly damaging	Het
Ccdc13	C	T	9: 121,819,581	G247R	probably damaging	Het
Cep97	T	A	16: 55,915,022	D471V	probably damaging	Het
Col17a1	A	T	19: 47,670,931	L403Q	probably damaging	Het
Crbn	A	G	6: 106,790,945	S194P	possibly damaging	Het
Dhx58	T	A	11: 100,703,574	H97L	probably benign	Het
Dpyd	A	G	3: 118,610,443		probably null	Het
Entpd1	A	T	19: 40,726,236	Q263L	probably benign	Het
Esyt3	T	C	9: 99,336,191	I130M	probably benign	Het
Etv1	T	C	12: 38,852,262	F264S	probably benign	Het
Fam189a2	A	T	19: 23,979,695	I317N	probably damaging	Het
Fam196b	T	A	11: 34,404,263		probably null	Het
Fam45a	A	G	19: 60,817,583	Y102C	probably damaging	Het
Fat1	T	C	8: 45,010,482	S1354P	probably benign	Het
Fat4	C	A	3: 38,951,155	T1901N	probably damaging	Het
Fbxw13	C	T	9: 109,181,518	V351I	probably damaging	Het
Fmo3	A	G	1: 162,967,787	F160L	possibly damaging	Het
Fyb2	T	A	4: 105,003,916	D592E	probably damaging	Het
Gjb4	T	C	4: 127,351,870	M93V	possibly damaging	Het
Gm5089	C	A	14: 122,436,154	G52*	probably null	Het
Gm6401	G	T	14: 41,966,883	N76K	probably benign	Het
Gm6871	A	G	7: 41,546,477	S279P	probably damaging	Het
Gtf2ird2	T	G	5: 134,211,240	V301G	probably benign	Het
H2bfm	A	C	X: 136,927,467	D35A	unknown	Het
Hfm1	A	G	5: 106,880,514	F817L	probably damaging	Het
Hfm1	T	C	5: 106,896,003	E589G	probably damaging	Het
Hivep2	A	T	10: 14,129,505	K616*	probably null	Het
Hmcn1	A	T	1: 150,675,984	I2623N	probably damaging	Het
Igf2bp3	G	T	6: 49,105,631	A339E	probably damaging	Het
Irx4	T	C	13: 73,267,638	I182T	possibly damaging	Het
Jcad	T	C	18: 4,674,511	S758P	probably damaging	Het
Klhdc4	A	T	8: 121,799,487	Y304*	probably null	Het
Lama1	A	G	17: 67,753,791	I705V	probably benign	Het
Mbd5	A	G	2: 49,257,032	N418S	probably benign	Het
Mmp21	C	T	7: 133,677,285	V279I	probably damaging	Het
Morc4	A	C	X: 139,854,530	C272W	probably damaging	Het
Mrm1	A	T	11: 84,818,692	C180S	probably damaging	Het
Ncor1	T	C	11: 62,423,005	D103G	probably damaging	Het
Ndrg4	A	G	8: 95,710,686	D251G	probably damaging	Het
Ndufaf5	T	C	2: 140,193,602	V246A	possibly damaging	Het
Noa1	T	C	5: 77,309,725	E111G	possibly damaging	Het
Nod1	C	A	6: 54,944,059	V425F	probably damaging	Het
Nos1	A	T	5: 117,895,919	I369F	probably damaging	Het
Nsun5	C	T	5: 135,371,316	H98Y	probably damaging	Het
Olfr1013	C	T	2: 85,769,855	T18I	probably benign	Het
Olfr172	A	G	16: 58,761,141	F12L	probably benign	Het
Olfr292	G	A	7: 86,695,110	R218H	probably benign	Het
Olfr726	C	G	14: 50,084,370	V104L	probably benign	Het
Olfr933	A	G	9: 38,975,906	I77V	probably damaging	Het
Olfr945	T	C	9: 39,258,571	I37V	probably benign	Het
Optn	G	A	2: 5,053,130	T76I	possibly damaging	Het
Oscar	C	T	7: 3,611,856	W22*	probably null	Het
Palmd	T	A	3: 116,923,657	Y397F	probably damaging	Het
Plk1	A	G	7: 122,168,898	D447G	probably damaging	Het
Plscr5	T	A	9: 92,205,528	N183K	probably damaging	Het
Polk	T	G	13: 96,489,204	D364A	probably damaging	Het
Polr3d	T	C	14: 70,443,010	T36A	probably benign	Het
Ppp1r10	A	T	17: 35,926,536	R199S	probably damaging	Het
Prkcz	C	T	4: 155,262,512	D388N	probably damaging	Het
Prrc2b	T	C	2: 32,212,222	L769P	probably damaging	Het
Psg26	A	G	7: 18,480,041	V232A	probably damaging	Het
Pth2r	T	C	1: 65,336,838	V85A	possibly damaging	Het
Rbpms2	T	C	9: 65,659,212		probably benign	Het
Reps1	A	T	10: 18,118,950	D514V	possibly damaging	Het
Riok3	G	T	18: 12,142,961	R238L	probably benign	Het
Rnf19a	T	C	15: 36,244,207	Q569R	probably damaging	Het
Rorb	G	A	19: 18,960,501	T267I	probably damaging	Het
Rrm2b	A	T	15: 37,929,096	M70K	probably damaging	Het
Rsf1	A	T	7: 97,662,349	E762V	possibly damaging	Het
S100a2	G	A	3: 90,591,392	V67I	probably benign	Het
Skp1a	T	A	11: 52,242,615	D42E	probably benign	Het
Slc22a4	A	T	11: 54,027,975	M1K	probably null	Het
Slc2a9	T	A	5: 38,382,044	Q371L	probably damaging	Het
Slc4a9	A	G	18: 36,532,022	T475A	probably benign	Het
Slc8b1	A	G	5: 120,519,652	N60S	probably damaging	Het
Slx4	A	C	16: 3,999,158	D66E	probably benign	Het
Smg8	A	T	11: 87,086,287	I156N	probably damaging	Het
Snx25	A	T	8: 46,116,207	C218S	possibly damaging	Het
Sulf2	T	C	2: 166,079,072	I784V	probably benign	Het
Tatdn2	G	T	6: 113,697,927	R72L	possibly damaging	Het
Tbc1d8	T	C	1: 39,406,837	D91G	possibly damaging	Het
Tifab	C	A	13: 56,176,620	R3S	probably benign	Het
Tm4sf1	A	T	3: 57,292,883	S104T	probably damaging	Het
Tmem132e	T	A	11: 82,443,517	I618N	probably damaging	Het
Ttc7b	A	T	12: 100,403,408	D367E	probably damaging	Het
Txlnb	A	G	10: 17,843,455	D678G	possibly damaging	Het
Vgll4	A	G	6: 114,957,934		probably null	Het
Vmn2r124	A	T	17: 18,061,925		probably benign	Het
Vmn2r2	T	C	3: 64,117,399	D587G	probably benign	Het
Vmn2r84	G	A	10: 130,391,099	A290V	probably benign	Het
Vps13c	T	A	9: 67,911,529	S1077R	probably benign	Het
Vsig10	C	T	5: 117,351,654	A495V	probably benign	Het
Vwa3a	A	T	7: 120,804,031		probably null	Het
Zfhx2	C	A	14: 55,065,998	A1510S	possibly damaging	Het
Zfp142	T	A	1: 74,572,230	D601V	probably damaging	Het
Zfp62	T	C	11: 49,217,683	I867T	probably benign	Het

Other mutations in Dnah8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00498:Dnah8	APN	17	30677176	missense	probably benign	0.06
IGL00508:Dnah8	APN	17	30855930	missense	probably damaging	1.00
IGL00547:Dnah8	APN	17	30815703	nonsense	probably null
IGL00551:Dnah8	APN	17	30663478	nonsense	probably null
IGL00732:Dnah8	APN	17	30656641	missense	probably damaging	1.00
IGL00775:Dnah8	APN	17	30767906	nonsense	probably null
IGL00840:Dnah8	APN	17	30790941	missense	probably damaging	1.00
IGL00845:Dnah8	APN	17	30819276	critical splice donor site	probably null
IGL00953:Dnah8	APN	17	30706457	nonsense	probably null
IGL00976:Dnah8	APN	17	30851710	missense	probably damaging	0.98
IGL01395:Dnah8	APN	17	30636005	missense	probably benign	0.06
IGL01467:Dnah8	APN	17	30779916	missense	probably damaging	1.00
IGL01469:Dnah8	APN	17	30683714	splice site	probably benign
IGL01515:Dnah8	APN	17	30648485	missense	probably benign
IGL01723:Dnah8	APN	17	30708471	missense	probably damaging	1.00
IGL01837:Dnah8	APN	17	30751591	critical splice donor site	probably null
IGL01921:Dnah8	APN	17	30736141	missense	probably benign
IGL01958:Dnah8	APN	17	30855895	splice site	probably benign
IGL01968:Dnah8	APN	17	30656598	nonsense	probably null
IGL02093:Dnah8	APN	17	30717880	missense	probably damaging	0.99
IGL02151:Dnah8	APN	17	30648417	missense	possibly damaging	0.50
IGL02182:Dnah8	APN	17	30794763	missense	possibly damaging	0.45
IGL02233:Dnah8	APN	17	30706513	critical splice donor site	probably null
IGL02236:Dnah8	APN	17	30649773	nonsense	probably null
IGL02259:Dnah8	APN	17	30759614	missense	probably benign
IGL02263:Dnah8	APN	17	30729165	missense	probably benign	0.00
IGL02303:Dnah8	APN	17	30713047	missense	probably benign	0.03
IGL02341:Dnah8	APN	17	30747257	missense	probably damaging	1.00
IGL02351:Dnah8	APN	17	30767811	missense	probably damaging	1.00
IGL02358:Dnah8	APN	17	30767811	missense	probably damaging	1.00
IGL02377:Dnah8	APN	17	30794796	missense	probably damaging	0.98
IGL02390:Dnah8	APN	17	30830845	missense	probably benign	0.01
IGL02392:Dnah8	APN	17	30818051	splice site	probably benign
IGL02414:Dnah8	APN	17	30700413	missense	probably benign
IGL02455:Dnah8	APN	17	30672334	missense	probably damaging	0.99
IGL02817:Dnah8	APN	17	30668295	missense	probably benign
IGL02831:Dnah8	APN	17	30712276	missense	probably benign	0.23
IGL02863:Dnah8	APN	17	30769697	missense	probably damaging	1.00
IGL02894:Dnah8	APN	17	30721110	nonsense	probably null
IGL02954:Dnah8	APN	17	30704835	missense	probably benign	0.30
IGL02964:Dnah8	APN	17	30746761	missense	probably damaging	1.00
IGL03080:Dnah8	APN	17	30719006	missense	probably benign	0.01
IGL03081:Dnah8	APN	17	30686373	splice site	probably benign
IGL03086:Dnah8	APN	17	30742780	missense	probably damaging	1.00
IGL03087:Dnah8	APN	17	30784144	missense	probably benign
IGL03176:Dnah8	APN	17	30694037	missense	probably benign
IGL03191:Dnah8	APN	17	30726830	missense	probably damaging	0.99
IGL03210:Dnah8	APN	17	30815665	missense	probably damaging	0.96
IGL03252:Dnah8	APN	17	30673920	splice site	probably null
IGL03255:Dnah8	APN	17	30741381	missense	probably damaging	1.00
IGL03288:Dnah8	APN	17	30672349	missense	probably benign
IGL03348:Dnah8	APN	17	30746986	missense	probably damaging	0.99
Alternator	UTSW	17	30765635	missense	probably benign
armature	UTSW	17	30708390	missense	probably benign	0.02
Brush	UTSW	17	30746990	missense	probably damaging	1.00
Dynos	UTSW	17	30715509	missense	possibly damaging	0.84
joule	UTSW	17	30713098	critical splice donor site	probably null
solenoid	UTSW	17	30741178	missense	probably damaging	1.00
FR4340:Dnah8	UTSW	17	30635463	small deletion	probably benign
FR4737:Dnah8	UTSW	17	30635465	small deletion	probably benign
FR4737:Dnah8	UTSW	17	30635477	small deletion	probably benign
I2288:Dnah8	UTSW	17	30663454	missense	probably benign
P0029:Dnah8	UTSW	17	30765720	missense	probably damaging	1.00
PIT4812001:Dnah8	UTSW	17	30708445	missense	probably benign	0.04
R0016:Dnah8	UTSW	17	30663316	missense	probably benign
R0035:Dnah8	UTSW	17	30683621	splice site	probably benign
R0035:Dnah8	UTSW	17	30683621	splice site	probably benign
R0062:Dnah8	UTSW	17	30765711	missense	probably damaging	1.00
R0062:Dnah8	UTSW	17	30765711	missense	probably damaging	1.00
R0087:Dnah8	UTSW	17	30755119	missense	probably damaging	1.00
R0090:Dnah8	UTSW	17	30784090	missense	probably benign	0.20
R0119:Dnah8	UTSW	17	30715509	missense	possibly damaging	0.84
R0164:Dnah8	UTSW	17	30748665	missense	probably benign
R0164:Dnah8	UTSW	17	30748665	missense	probably benign
R0184:Dnah8	UTSW	17	30683683	missense	probably benign	0.04
R0240:Dnah8	UTSW	17	30765679	missense	probably damaging	0.98
R0240:Dnah8	UTSW	17	30765679	missense	probably damaging	0.98
R0241:Dnah8	UTSW	17	30765679	missense	probably damaging	0.98
R0241:Dnah8	UTSW	17	30765679	missense	probably damaging	0.98
R0265:Dnah8	UTSW	17	30690271	missense	probably benign
R0268:Dnah8	UTSW	17	30769707	missense	probably damaging	1.00
R0282:Dnah8	UTSW	17	30736156	missense	probably damaging	1.00
R0299:Dnah8	UTSW	17	30715509	missense	possibly damaging	0.84
R0334:Dnah8	UTSW	17	30871351	missense	probably damaging	0.99
R0393:Dnah8	UTSW	17	30708390	missense	probably benign	0.02
R0423:Dnah8	UTSW	17	30701981	missense	probably benign
R0470:Dnah8	UTSW	17	30708540	splice site	probably benign
R0477:Dnah8	UTSW	17	30755080	missense	probably damaging	1.00
R0490:Dnah8	UTSW	17	30700419	missense	probably benign
R0499:Dnah8	UTSW	17	30715509	missense	possibly damaging	0.84
R0582:Dnah8	UTSW	17	30718961	missense	probably benign	0.01
R0601:Dnah8	UTSW	17	30708358	missense	probably benign	0.06
R0646:Dnah8	UTSW	17	30684173	missense	probably damaging	0.97
R0665:Dnah8	UTSW	17	30736155	missense	probably damaging	0.99
R0800:Dnah8	UTSW	17	30704662	missense	probably benign
R0843:Dnah8	UTSW	17	30813095	missense	probably damaging	1.00
R0940:Dnah8	UTSW	17	30803243	missense	probably damaging	1.00
R0964:Dnah8	UTSW	17	30673920	splice site	probably null
R1102:Dnah8	UTSW	17	30854764	splice site	probably null
R1137:Dnah8	UTSW	17	30855936	missense	probably damaging	1.00
R1342:Dnah8	UTSW	17	30721000	missense	probably damaging	0.99
R1375:Dnah8	UTSW	17	30737295	missense	probably damaging	1.00
R1377:Dnah8	UTSW	17	30840622	nonsense	probably null
R1464:Dnah8	UTSW	17	30695173	missense	possibly damaging	0.81
R1464:Dnah8	UTSW	17	30695173	missense	possibly damaging	0.81
R1470:Dnah8	UTSW	17	30747277	nonsense	probably null
R1470:Dnah8	UTSW	17	30747277	nonsense	probably null
R1497:Dnah8	UTSW	17	30752075	missense	probably damaging	1.00
R1513:Dnah8	UTSW	17	30673888	missense	probably benign
R1541:Dnah8	UTSW	17	30747247	missense	probably damaging	1.00
R1563:Dnah8	UTSW	17	30635664	missense	probably benign	0.07
R1634:Dnah8	UTSW	17	30713098	critical splice donor site	probably null
R1670:Dnah8	UTSW	17	30725124	missense	probably damaging	1.00
R1743:Dnah8	UTSW	17	30769651	missense	probably benign	0.28
R1761:Dnah8	UTSW	17	30779916	missense	probably damaging	1.00
R1785:Dnah8	UTSW	17	30722937	missense	probably damaging	0.98
R1804:Dnah8	UTSW	17	30708407	missense	probably benign	0.00
R1808:Dnah8	UTSW	17	30684186	missense	probably damaging	1.00
R1824:Dnah8	UTSW	17	30731180	missense	possibly damaging	0.67
R1836:Dnah8	UTSW	17	30874927	missense	possibly damaging	0.94
R1935:Dnah8	UTSW	17	30635505	missense	unknown
R1935:Dnah8	UTSW	17	30726896	splice site	probably benign
R1940:Dnah8	UTSW	17	30731207	missense	probably damaging	1.00
R1946:Dnah8	UTSW	17	30712385	missense	probably benign	0.00
R2025:Dnah8	UTSW	17	30731159	missense	probably damaging	0.99
R2038:Dnah8	UTSW	17	30758281	missense	probably damaging	1.00
R2042:Dnah8	UTSW	17	30635658	missense	probably benign	0.01
R2148:Dnah8	UTSW	17	30737258	missense	probably damaging	1.00
R2177:Dnah8	UTSW	17	30653393	missense	probably benign
R2180:Dnah8	UTSW	17	30840647	missense	probably benign	0.00
R2262:Dnah8	UTSW	17	30673835	missense	probably damaging	1.00
R2263:Dnah8	UTSW	17	30673835	missense	probably damaging	1.00
R2328:Dnah8	UTSW	17	30794744	missense	probably damaging	1.00
R2357:Dnah8	UTSW	17	30771872	missense	probably benign
R2357:Dnah8	UTSW	17	30874935	missense	probably benign	0.00
R2360:Dnah8	UTSW	17	30677204	missense	probably benign	0.22
R2496:Dnah8	UTSW	17	30851731	missense	probably damaging	1.00
R2497:Dnah8	UTSW	17	30741365	nonsense	probably null
R2509:Dnah8	UTSW	17	30775045	missense	probably benign	0.02
R3114:Dnah8	UTSW	17	30833568	missense	probably benign	0.04
R3708:Dnah8	UTSW	17	30739657	missense	probably damaging	0.98
R3720:Dnah8	UTSW	17	30854898	missense	probably damaging	1.00
R3722:Dnah8	UTSW	17	30854898	missense	probably damaging	1.00
R3727:Dnah8	UTSW	17	30739648	nonsense	probably null
R3747:Dnah8	UTSW	17	30784174	nonsense	probably null
R3748:Dnah8	UTSW	17	30784174	nonsense	probably null
R3749:Dnah8	UTSW	17	30784174	nonsense	probably null
R3787:Dnah8	UTSW	17	30755041	missense	probably damaging	1.00
R3790:Dnah8	UTSW	17	30854898	missense	probably damaging	1.00
R3804:Dnah8	UTSW	17	30670647	missense	probably benign	0.00
R3857:Dnah8	UTSW	17	30663422	missense	probably damaging	0.96
R3898:Dnah8	UTSW	17	30854898	missense	probably damaging	1.00
R3899:Dnah8	UTSW	17	30854898	missense	probably damaging	1.00
R3938:Dnah8	UTSW	17	30854937	missense	probably damaging	1.00
R3943:Dnah8	UTSW	17	30694065	splice site	probably benign
R4091:Dnah8	UTSW	17	30769839	missense	probably damaging	1.00
R4291:Dnah8	UTSW	17	30748559	missense	probably benign
R4326:Dnah8	UTSW	17	30752092	missense	probably benign	0.04
R4346:Dnah8	UTSW	17	30725098	missense	possibly damaging	0.92
R4429:Dnah8	UTSW	17	30752146	missense	probably damaging	1.00
R4457:Dnah8	UTSW	17	30813151	missense	probably benign
R4475:Dnah8	UTSW	17	30656985	missense	probably benign	0.12
R4565:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R4566:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R4568:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R4573:Dnah8	UTSW	17	30700406	missense	probably benign	0.00
R4580:Dnah8	UTSW	17	30662052	missense	probably benign	0.00
R4585:Dnah8	UTSW	17	30751567	missense	probably benign	0.01
R4611:Dnah8	UTSW	17	30684237	missense	probably damaging	1.00
R4720:Dnah8	UTSW	17	30683634	missense	probably benign	0.08
R4721:Dnah8	UTSW	17	30725166	missense	probably damaging	1.00
R4727:Dnah8	UTSW	17	30851747	missense	probably damaging	1.00
R4731:Dnah8	UTSW	17	30775061	missense	probably null	0.02
R4732:Dnah8	UTSW	17	30775061	missense	probably null	0.02
R4733:Dnah8	UTSW	17	30775061	missense	probably null	0.02
R4798:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R4814:Dnah8	UTSW	17	30767924	missense	probably damaging	1.00
R4892:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R4894:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R4900:Dnah8	UTSW	17	30746975	missense	probably damaging	1.00
R4901:Dnah8	UTSW	17	30840714	critical splice donor site	probably null
R4913:Dnah8	UTSW	17	30819139	missense	probably damaging	0.99
R4931:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R4932:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R4933:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R4942:Dnah8	UTSW	17	30729142	missense	probably benign
R4969:Dnah8	UTSW	17	30723014	missense	probably damaging	1.00
R4975:Dnah8	UTSW	17	30656985	missense	probably benign	0.12
R4977:Dnah8	UTSW	17	30663301	missense	probably benign	0.00
R5001:Dnah8	UTSW	17	30787185	missense	probably damaging	1.00
R5011:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R5013:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R5014:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R5024:Dnah8	UTSW	17	30736096	missense	probably damaging	1.00
R5075:Dnah8	UTSW	17	30739757	critical splice donor site	probably null
R5075:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R5075:Dnah8	UTSW	17	30800531	missense	probably damaging	1.00
R5112:Dnah8	UTSW	17	30731038	missense	probably benign	0.02
R5121:Dnah8	UTSW	17	30810353	missense	probably benign	0.14
R5138:Dnah8	UTSW	17	30765597	missense	probably damaging	0.99
R5151:Dnah8	UTSW	17	30712295	missense	probably benign	0.06
R5191:Dnah8	UTSW	17	30746765	missense	probably damaging	1.00
R5238:Dnah8	UTSW	17	30790917	missense	probably damaging	1.00
R5260:Dnah8	UTSW	17	30700419	missense	probably benign
R5358:Dnah8	UTSW	17	30746954	missense	probably damaging	1.00
R5403:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R5404:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R5482:Dnah8	UTSW	17	30800547	missense	probably damaging	0.96
R5489:Dnah8	UTSW	17	30790956	missense	probably damaging	1.00
R5513:Dnah8	UTSW	17	30752916	missense	probably damaging	0.99
R5635:Dnah8	UTSW	17	30706386	missense	probably benign	0.00
R5640:Dnah8	UTSW	17	30803108	missense	probably damaging	1.00
R5649:Dnah8	UTSW	17	30800587	missense	probably benign	0.13
R5662:Dnah8	UTSW	17	30737333	missense	probably damaging	1.00
R5673:Dnah8	UTSW	17	30803261	missense	probably damaging	1.00
R5677:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R5699:Dnah8	UTSW	17	30810324	missense	probably benign	0.22
R5737:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R5738:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R5739:Dnah8	UTSW	17	30719007	missense	probably benign	0.00
R5766:Dnah8	UTSW	17	30690261	missense	probably benign	0.01
R5790:Dnah8	UTSW	17	30875004	missense	probably damaging	0.98
R5848:Dnah8	UTSW	17	30728191	missense	possibly damaging	0.69
R5854:Dnah8	UTSW	17	30794763	missense	possibly damaging	0.45
R5885:Dnah8	UTSW	17	30794717	missense	probably damaging	1.00
R5886:Dnah8	UTSW	17	30794717	missense	probably damaging	1.00
R5887:Dnah8	UTSW	17	30794717	missense	probably damaging	1.00
R5899:Dnah8	UTSW	17	30656685	missense	probably benign	0.32
R5979:Dnah8	UTSW	17	30815664	nonsense	probably null
R5986:Dnah8	UTSW	17	30851630	missense	possibly damaging	0.83
R5999:Dnah8	UTSW	17	30663305	missense	probably benign	0.32
R6042:Dnah8	UTSW	17	30747265	missense	probably damaging	1.00
R6175:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6181:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6237:Dnah8	UTSW	17	30747854	nonsense	probably null
R6239:Dnah8	UTSW	17	30810359	missense	probably damaging	0.99
R6337:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6365:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6416:Dnah8	UTSW	17	30765635	missense	probably benign
R6443:Dnah8	UTSW	17	30771885	missense	probably benign	0.10
R6478:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6479:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6480:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6481:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6533:Dnah8	UTSW	17	30746990	missense	probably damaging	1.00
R6606:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6608:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6610:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6675:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6723:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6724:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6754:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6755:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6759:Dnah8	UTSW	17	30663292	splice site	probably null
R6765:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6766:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6778:Dnah8	UTSW	17	30635666	missense	probably benign	0.00
R6781:Dnah8	UTSW	17	30765724	frame shift	probably null
R6788:Dnah8	UTSW	17	30648465	missense	probably benign	0.14
R6814:Dnah8	UTSW	17	30762679	missense	probably damaging	1.00
R6825:Dnah8	UTSW	17	30741173	missense	probably damaging	1.00
R6838:Dnah8	UTSW	17	30710551	missense	probably damaging	1.00
R6872:Dnah8	UTSW	17	30762679	missense	probably damaging	1.00
R6877:Dnah8	UTSW	17	30746959	missense	probably damaging	1.00
R6944:Dnah8	UTSW	17	30794659	missense	probably benign	0.09
R6982:Dnah8	UTSW	17	30767925	missense	probably benign	0.03
R6984:Dnah8	UTSW	17	30739738	missense	probably damaging	1.00
R6987:Dnah8	UTSW	17	30662091	missense	possibly damaging	0.95
R6988:Dnah8	UTSW	17	30643275	missense	probably damaging	1.00
R7099:Dnah8	UTSW	17	30704724	missense	possibly damaging	0.93
R7106:Dnah8	UTSW	17	30741178	missense	probably damaging	1.00
R7112:Dnah8	UTSW	17	30871392	missense	possibly damaging	0.79
R7146:Dnah8	UTSW	17	30644617	missense	probably benign	0.01
R7146:Dnah8	UTSW	17	30769644	missense	possibly damaging	0.90
R7309:Dnah8	UTSW	17	30875014	missense	probably damaging	1.00
R7324:Dnah8	UTSW	17	30784125	missense	probably benign	0.01
R7373:Dnah8	UTSW	17	30767965	critical splice donor site	probably null
R7423:Dnah8	UTSW	17	30704769	missense	possibly damaging	0.86
R7430:Dnah8	UTSW	17	30706389	missense	probably damaging	0.98
R7450:Dnah8	UTSW	17	30787191	missense	probably damaging	0.99
R7580:Dnah8	UTSW	17	30775103	missense	probably damaging	0.98
R7604:Dnah8	UTSW	17	30813095	missense	probably damaging	1.00
R7635:Dnah8	UTSW	17	30785107	missense	probably damaging	1.00
R7646:Dnah8	UTSW	17	30649677	missense	probably benign	0.00
R7685:Dnah8	UTSW	17	30657973	missense	probably damaging	1.00
R7793:Dnah8	UTSW	17	30855944	missense	probably benign	0.20
R7827:Dnah8	UTSW	17	30760867	frame shift	probably null
R7866:Dnah8	UTSW	17	30874927	missense	possibly damaging	0.94
R7877:Dnah8	UTSW	17	30663374	missense	probably benign
R7891:Dnah8	UTSW	17	30712289	missense	probably benign	0.09
R7977:Dnah8	UTSW	17	30744524	missense	probably damaging	1.00
R7987:Dnah8	UTSW	17	30744524	missense	probably damaging	1.00
R8025:Dnah8	UTSW	17	30741337	nonsense	probably null
R8076:Dnah8	UTSW	17	30784153	missense	possibly damaging	0.94
R8170:Dnah8	UTSW	17	30673823	missense	probably damaging	1.00
R8199:Dnah8	UTSW	17	30871419	missense	probably benign	0.06
R8253:Dnah8	UTSW	17	30760867	frame shift	probably null
R8270:Dnah8	UTSW	17	30840713	missense	probably damaging	1.00
R8291:Dnah8	UTSW	17	30765727	missense	probably damaging	1.00
R8334:Dnah8	UTSW	17	30769831	missense	probably benign	0.12
R8348:Dnah8	UTSW	17	30673840	missense	probably benign
R8348:Dnah8	UTSW	17	30736147	missense	probably damaging	0.96
R8354:Dnah8	UTSW	17	30643260	missense	probably benign	0.17
R8355:Dnah8	UTSW	17	30695178	missense	possibly damaging	0.89
R8439:Dnah8	UTSW	17	30760867	frame shift	probably null
R8448:Dnah8	UTSW	17	30673840	missense	probably benign
R8459:Dnah8	UTSW	17	30725247	critical splice donor site	probably null
R8462:Dnah8	UTSW	17	30656629	missense	probably damaging	1.00
R8506:Dnah8	UTSW	17	30721134	missense	probably benign
R8524:Dnah8	UTSW	17	30715498	missense	possibly damaging	0.95
R8555:Dnah8	UTSW	17	30721110	nonsense	probably null
R8698:Dnah8	UTSW	17	30875035	missense	probably damaging	1.00
R8719:Dnah8	UTSW	17	30741315	missense	probably damaging	0.97
R8778:Dnah8	UTSW	17	30760867	frame shift	probably null
R8781:Dnah8	UTSW	17	30725104	missense	probably damaging	1.00
R8821:Dnah8	UTSW	17	30794738	missense	probably damaging	1.00
R8864:Dnah8	UTSW	17	30762642	missense	possibly damaging	0.95
R8885:Dnah8	UTSW	17	30708312	missense	possibly damaging	0.83
R8983:Dnah8	UTSW	17	30851654	missense	probably damaging	0.98
R8994:Dnah8	UTSW	17	30790833	missense	probably benign	0.05
R9031:Dnah8	UTSW	17	30737427	missense	probably damaging	1.00
R9068:Dnah8	UTSW	17	30756755	missense	possibly damaging	0.63
R9225:Dnah8	UTSW	17	30635673	missense	probably benign	0.01
R9280:Dnah8	UTSW	17	30785097	missense	possibly damaging	0.52
R9291:Dnah8	UTSW	17	30725125	missense	probably damaging	1.00
R9314:Dnah8	UTSW	17	30771883	missense	probably benign
R9347:Dnah8	UTSW	17	30708359	missense	probably benign	0.00
R9393:Dnah8	UTSW	17	30653387	missense	possibly damaging	0.53
R9415:Dnah8	UTSW	17	30810323	missense	probably benign	0.02
R9458:Dnah8	UTSW	17	30830803	missense	probably damaging	1.00
R9465:Dnah8	UTSW	17	30760867	frame shift	probably null
R9518:Dnah8	UTSW	17	30760867	frame shift	probably null
R9524:Dnah8	UTSW	17	30760867	frame shift	probably null
R9564:Dnah8	UTSW	17	30713047	missense	probably benign	0.07
R9587:Dnah8	UTSW	17	30760867	frame shift	probably null
R9599:Dnah8	UTSW	17	30760867	frame shift	probably null
R9641:Dnah8	UTSW	17	30713055	missense	probably benign	0.13
R9674:Dnah8	UTSW	17	30779138	missense	possibly damaging	0.84
R9679:Dnah8	UTSW	17	30818141	missense	probably benign
R9789:Dnah8	UTSW	17	30761130	critical splice donor site	probably null
RF027:Dnah8	UTSW	17	30635476	frame shift	probably null
X0001:Dnah8	UTSW	17	30748680	missense	probably damaging	1.00
X0013:Dnah8	UTSW	17	30819186	missense	possibly damaging	0.71
Z1176:Dnah8	UTSW	17	30648540	missense	probably benign
Z1177:Dnah8	UTSW	17	30694033	missense	probably benign
Z1177:Dnah8	UTSW	17	30713095	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- CGCTACTTTGTTTCAGGTGAAAGCTC -3'
(R):5'- CGGACACATACACGATTCAAACGGAA -3'

Sequencing Primer
(F):5'- AGGTGAAAGCTCGCTTGATG -3'
(R):5'- gagggagggagaggcag -3'

Posted On

2014-05-14