Incidental Mutation 'R1711:Pik3c2a'
ID 190561
Institutional Source Beutler Lab
Gene Symbol Pik3c2a
Ensembl Gene ENSMUSG00000030660
Gene Name phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha
Synonyms PI3KC2
MMRRC Submission 039744-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1711 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 116337265-116443449 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 116417927 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 198 (Y198*)
Ref Sequence ENSEMBL: ENSMUSP00000146181 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170430] [ENSMUST00000205378] [ENSMUST00000206219]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000170430
AA Change: Y198*
SMART Domains Protein: ENSMUSP00000126092
Gene: ENSMUSG00000030660
AA Change: Y198*

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
low complexity region 361 372 N/A INTRINSIC
PI3K_rbd 410 513 3.08e-38 SMART
PI3K_C2 674 783 2.71e-34 SMART
PI3Ka 860 1047 3.62e-85 SMART
PI3Kc 1134 1396 3.1e-125 SMART
PX 1422 1534 5.68e-30 SMART
C2 1573 1677 3.93e-14 SMART
Predicted Effect probably null
Transcript: ENSMUST00000205378
AA Change: Y198*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205767
Predicted Effect probably null
Transcript: ENSMUST00000206219
AA Change: Y198*
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. The PI3-kinase activity of this protein is not sensitive to nanomolar levels of the inhibitor wortmanin. This protein was shown to be able to be activated by insulin and may be involved in integrin-dependent signaling. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele show chronic renal failure and a range of renal lesions that precede immune involvement. Mice heterozygous for a kinase-inactivating allele show defects in platelet formation, platelet membrane morphology and dynamics, and an enrichment of barbell proplatelets. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 111 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C T 13: 77,269,920 T741I possibly damaging Het
Acot3 A T 12: 84,053,573 Q41L probably damaging Het
Actl7b G A 4: 56,740,165 Q398* probably null Het
Adgrb2 C A 4: 129,992,624 Q186K probably damaging Het
Akr1a1 A G 4: 116,637,974 probably null Het
Ap3s2 A T 7: 79,880,490 F192L probably damaging Het
Apobr T G 7: 126,584,979 probably null Het
Arhgap5 A G 12: 52,519,345 N1033S probably damaging Het
Arid3c G T 4: 41,725,947 R219S probably damaging Het
Bves C T 10: 45,347,865 T207M probably damaging Het
C330027C09Rik A C 16: 49,017,486 I850L probably benign Het
Cacna1d T C 14: 30,066,056 K1619R probably damaging Het
Caps2 A T 10: 112,190,978 D223V possibly damaging Het
Cd163l1 G T 7: 140,220,609 C101F probably damaging Het
Cd3g A C 9: 44,974,342 L35R probably damaging Het
Cdh23 A T 10: 60,523,536 V261E probably benign Het
Cfap54 T G 10: 93,011,020 T1028P probably damaging Het
Ch25h C A 19: 34,474,286 V281L probably benign Het
Clu G T 14: 65,980,905 V405L possibly damaging Het
Col6a3 A T 1: 90,830,213 H6Q probably damaging Het
Cps1 G A 1: 67,168,374 probably null Het
Ctr9 T C 7: 111,055,663 S1134P unknown Het
Cts7 C T 13: 61,352,810 G308S probably damaging Het
Cyp2c39 C A 19: 39,566,891 T385K probably damaging Het
Dennd5a A T 7: 109,918,712 D596E probably benign Het
Disc1 T A 8: 125,124,610 I413K probably benign Het
Dll3 C T 7: 28,294,497 G505D probably damaging Het
Dnah3 A G 7: 120,078,571 W377R probably damaging Het
Dopey2 A G 16: 93,799,926 D1792G probably damaging Het
Dpep3 T A 8: 105,973,693 R460S probably benign Het
Ebf4 A G 2: 130,358,831 N302S probably damaging Het
Egflam T C 15: 7,289,915 E194G possibly damaging Het
Ep400 A T 5: 110,693,308 probably benign Het
Ercc6 T C 14: 32,526,176 M228T probably damaging Het
Fbxo9 T C 9: 78,087,247 T264A probably damaging Het
Fcrl5 C A 3: 87,457,414 P486T possibly damaging Het
Fyb T C 15: 6,580,479 F178L probably damaging Het
Gaa T A 11: 119,280,460 I646N probably damaging Het
Gm11639 A G 11: 104,720,688 K452R probably benign Het
Gm13124 A T 4: 144,555,406 I272K probably damaging Het
Gm5431 A T 11: 48,895,026 V174E possibly damaging Het
Gnpat T G 8: 124,886,952 probably null Het
Gucy1a2 G T 9: 3,759,622 R476I probably benign Het
Hars A G 18: 36,771,103 L241P probably damaging Het
Haus5 G A 7: 30,657,903 Q399* probably null Het
Hephl1 T C 9: 15,059,246 E984G probably damaging Het
Hmces C T 6: 87,921,592 Q132* probably null Het
Hsp90b1 G T 10: 86,694,525 T490K probably damaging Het
Idh2 T G 7: 80,099,158 E125A probably damaging Het
Ipo13 G T 4: 117,904,522 H465Q probably benign Het
Isca2 C A 12: 84,773,619 T31K probably damaging Het
Itga9 T C 9: 118,698,461 V560A probably benign Het
Jhy G A 9: 40,911,157 Q562* probably null Het
Kcnj5 A G 9: 32,322,569 I150T probably damaging Het
Kmt2a A G 9: 44,841,621 I1419T unknown Het
Lix1 T C 17: 17,446,058 F160L possibly damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Map4k1 A T 7: 28,989,352 Q276L possibly damaging Het
Mmp9 G A 2: 164,949,422 G171S probably damaging Het
Mvp C A 7: 126,995,735 probably null Het
Mylk3 T A 8: 85,364,831 E115V probably damaging Het
Nebl T A 2: 17,388,754 T603S probably damaging Het
Nudt15 T C 14: 73,523,336 D105G probably benign Het
Olfr1369-ps1 G A 13: 21,116,306 V205I probably benign Het
Olfr527 A C 7: 140,335,999 T46P possibly damaging Het
Olfr556 G T 7: 102,670,162 V81L probably damaging Het
Olfr65 T A 7: 103,906,699 W87R probably damaging Het
Olfr685 A T 7: 105,180,760 H199Q probably damaging Het
Olfr971 A G 9: 39,840,285 M284V probably benign Het
Osbpl9 A T 4: 109,066,218 C495S probably damaging Het
Pamr1 A G 2: 102,640,852 T507A probably benign Het
Pcdhb9 T A 18: 37,403,327 C791* probably null Het
Pcgf6 T C 19: 47,050,518 E101G probably damaging Het
Pdgfrl A T 8: 40,985,794 I256F probably benign Het
Pdzd7 T C 19: 45,045,511 R45G possibly damaging Het
Pecr C T 1: 72,277,409 V46I possibly damaging Het
Pgr A G 9: 8,922,714 probably null Het
Pp2d1 T A 17: 53,515,310 M243L possibly damaging Het
Ppp1r1a T A 15: 103,533,492 I50L possibly damaging Het
Proc T C 18: 32,127,406 D222G probably benign Het
Ptprq T A 10: 107,534,699 R2044* probably null Het
Ranbp2 T C 10: 58,460,519 V326A probably benign Het
Reep6 T A 10: 80,333,981 F122I possibly damaging Het
Rubcn C A 16: 32,843,101 R388S probably damaging Het
Rusc1 A G 3: 89,089,293 L62P probably damaging Het
Satb2 T C 1: 56,850,289 N423S probably damaging Het
Serpinb9d A G 13: 33,200,748 K236R probably benign Het
Slc4a7 A G 14: 14,765,709 R680G probably benign Het
Slitrk1 T A 14: 108,913,096 Y61F probably benign Het
Son A G 16: 91,660,226 probably benign Het
Sparc T A 11: 55,395,776 probably null Het
Spon2 A G 5: 33,216,385 F194S probably damaging Het
Spta1 A G 1: 174,241,042 E2136G probably damaging Het
Stat4 T C 1: 52,106,925 S746P probably damaging Het
Stk31 T A 6: 49,469,304 S958R probably benign Het
Stom T A 2: 35,315,917 I267F probably damaging Het
Stx12 A T 4: 132,858,477 D197E probably damaging Het
Taok3 A T 5: 117,255,926 N588I possibly damaging Het
Tgs1 A G 4: 3,598,658 D657G probably damaging Het
Trim6 A G 7: 104,232,837 T432A probably damaging Het
Trim72 C G 7: 128,004,585 C34W probably damaging Het
Trpc4ap A T 2: 155,657,744 I286N probably benign Het
Ttn A G 2: 76,863,561 V321A possibly damaging Het
Utp4 T A 8: 106,918,720 I583N probably damaging Het
Wdfy2 G T 14: 62,944,097 M225I probably benign Het
Wfdc1 A G 8: 119,681,037 T134A probably benign Het
Wnt9b A G 11: 103,732,128 S150P probably damaging Het
Zbtb46 A T 2: 181,411,684 F412I probably damaging Het
Zc3h15 G A 2: 83,661,148 R240H probably benign Het
Zfp11 A T 5: 129,656,673 Y575N probably benign Het
Zfp687 T C 3: 95,011,889 M191V probably benign Het
Other mutations in Pik3c2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Pik3c2a APN 7 116376283 missense possibly damaging 0.50
IGL00732:Pik3c2a APN 7 116364500 missense possibly damaging 0.82
IGL01303:Pik3c2a APN 7 116373803 missense possibly damaging 0.94
IGL01443:Pik3c2a APN 7 116418194 missense probably benign 0.01
IGL01462:Pik3c2a APN 7 116376250 missense possibly damaging 0.94
IGL01641:Pik3c2a APN 7 116350765 intron probably benign
IGL01695:Pik3c2a APN 7 116417518 missense possibly damaging 0.82
IGL02095:Pik3c2a APN 7 116346188 missense probably damaging 1.00
IGL02137:Pik3c2a APN 7 116350804 missense probably benign 0.00
IGL02160:Pik3c2a APN 7 116388064 missense probably damaging 1.00
IGL02224:Pik3c2a APN 7 116363340 splice site probably benign
IGL02345:Pik3c2a APN 7 116405891 missense probably damaging 1.00
IGL02644:Pik3c2a APN 7 116372814 missense probably benign 0.00
IGL02756:Pik3c2a APN 7 116364513 missense probably benign 0.01
IGL03339:Pik3c2a APN 7 116418021 missense possibly damaging 0.57
IGL03412:Pik3c2a APN 7 116417839 missense probably benign 0.21
R0046:Pik3c2a UTSW 7 116354072 missense probably damaging 1.00
R0387:Pik3c2a UTSW 7 116373744 missense probably damaging 1.00
R0501:Pik3c2a UTSW 7 116354055 missense probably damaging 1.00
R0650:Pik3c2a UTSW 7 116346247 splice site probably benign
R0991:Pik3c2a UTSW 7 116362045 critical splice donor site probably null
R1074:Pik3c2a UTSW 7 116350925 nonsense probably null
R1485:Pik3c2a UTSW 7 116417673 missense possibly damaging 0.50
R1495:Pik3c2a UTSW 7 116388065 missense probably benign 0.01
R1510:Pik3c2a UTSW 7 116388045 missense probably benign 0.00
R1654:Pik3c2a UTSW 7 116368848 missense probably benign 0.02
R1733:Pik3c2a UTSW 7 116418520 start codon destroyed possibly damaging 0.96
R1751:Pik3c2a UTSW 7 116346236 missense probably damaging 0.98
R1812:Pik3c2a UTSW 7 116417664 missense probably damaging 0.98
R1817:Pik3c2a UTSW 7 116376512 critical splice donor site probably null
R1826:Pik3c2a UTSW 7 116368117 missense probably benign
R1875:Pik3c2a UTSW 7 116417971 missense probably benign 0.35
R1995:Pik3c2a UTSW 7 116354006 missense probably damaging 1.00
R2007:Pik3c2a UTSW 7 116342237 missense probably damaging 1.00
R2009:Pik3c2a UTSW 7 116364503 missense probably damaging 1.00
R2013:Pik3c2a UTSW 7 116350931 critical splice acceptor site probably null
R2014:Pik3c2a UTSW 7 116350931 critical splice acceptor site probably null
R2015:Pik3c2a UTSW 7 116350931 critical splice acceptor site probably null
R2027:Pik3c2a UTSW 7 116350822 missense probably damaging 1.00
R2050:Pik3c2a UTSW 7 116417451 critical splice donor site probably null
R2068:Pik3c2a UTSW 7 116372891 nonsense probably null
R3814:Pik3c2a UTSW 7 116348179 missense probably damaging 1.00
R3848:Pik3c2a UTSW 7 116364550 nonsense probably null
R4386:Pik3c2a UTSW 7 116354099 missense probably damaging 1.00
R4668:Pik3c2a UTSW 7 116358688 missense probably benign 0.16
R4783:Pik3c2a UTSW 7 116417825 missense probably damaging 1.00
R4860:Pik3c2a UTSW 7 116340156 missense probably damaging 1.00
R4860:Pik3c2a UTSW 7 116340156 missense probably damaging 1.00
R5057:Pik3c2a UTSW 7 116376283 missense possibly damaging 0.50
R5080:Pik3c2a UTSW 7 116348274 missense probably damaging 1.00
R5083:Pik3c2a UTSW 7 116342401 missense probably damaging 1.00
R5144:Pik3c2a UTSW 7 116350786 missense probably benign 0.01
R5589:Pik3c2a UTSW 7 116417658 missense probably benign 0.02
R5646:Pik3c2a UTSW 7 116405951 missense probably damaging 1.00
R5829:Pik3c2a UTSW 7 116372814 missense probably benign 0.00
R5951:Pik3c2a UTSW 7 116368184 missense probably damaging 0.96
R5958:Pik3c2a UTSW 7 116362564 missense probably damaging 1.00
R6356:Pik3c2a UTSW 7 116348205 missense possibly damaging 0.46
R6551:Pik3c2a UTSW 7 116417496 missense probably damaging 0.97
R6641:Pik3c2a UTSW 7 116340225 critical splice acceptor site probably null
R6661:Pik3c2a UTSW 7 116368758 missense possibly damaging 0.77
R6789:Pik3c2a UTSW 7 116362184 missense probably damaging 1.00
R6874:Pik3c2a UTSW 7 116394305 missense probably damaging 1.00
R6985:Pik3c2a UTSW 7 116417988 missense probably damaging 0.98
R7106:Pik3c2a UTSW 7 116418133 nonsense probably null
R7153:Pik3c2a UTSW 7 116342252 missense probably damaging 1.00
R7176:Pik3c2a UTSW 7 116388096 missense possibly damaging 0.47
R7265:Pik3c2a UTSW 7 116388086 missense probably damaging 1.00
R7303:Pik3c2a UTSW 7 116405943 missense probably benign 0.00
R7308:Pik3c2a UTSW 7 116373839 missense probably damaging 1.00
R7375:Pik3c2a UTSW 7 116376386 missense probably damaging 1.00
R7406:Pik3c2a UTSW 7 116354007 missense probably damaging 1.00
R7426:Pik3c2a UTSW 7 116372854 missense probably damaging 1.00
R7528:Pik3c2a UTSW 7 116394239 missense probably damaging 1.00
R7539:Pik3c2a UTSW 7 116340096 missense probably damaging 0.97
R7684:Pik3c2a UTSW 7 116388077 nonsense probably null
R7737:Pik3c2a UTSW 7 116356253 missense probably damaging 0.99
R7739:Pik3c2a UTSW 7 116394294 missense probably benign 0.26
R7852:Pik3c2a UTSW 7 116417458 missense probably benign
R7922:Pik3c2a UTSW 7 116391282 missense probably damaging 1.00
R7956:Pik3c2a UTSW 7 116350115 missense probably benign 0.01
R8005:Pik3c2a UTSW 7 116418036 missense probably damaging 1.00
R8158:Pik3c2a UTSW 7 116342997 missense probably benign 0.00
R8329:Pik3c2a UTSW 7 116418048 missense probably damaging 1.00
R8478:Pik3c2a UTSW 7 116418349 missense probably damaging 0.96
R8736:Pik3c2a UTSW 7 116376229 missense possibly damaging 0.47
R8812:Pik3c2a UTSW 7 116351877 missense probably damaging 1.00
R8922:Pik3c2a UTSW 7 116418424 missense probably damaging 1.00
R8953:Pik3c2a UTSW 7 116388085 missense probably benign 0.19
R9105:Pik3c2a UTSW 7 116372814 missense probably benign 0.00
R9111:Pik3c2a UTSW 7 116394296 missense probably damaging 0.99
R9152:Pik3c2a UTSW 7 116417769 missense probably benign 0.30
R9241:Pik3c2a UTSW 7 116417880 missense probably benign 0.02
R9301:Pik3c2a UTSW 7 116346178 missense probably damaging 1.00
R9325:Pik3c2a UTSW 7 116391323 missense probably damaging 0.99
R9482:Pik3c2a UTSW 7 116362054 missense probably benign 0.04
R9513:Pik3c2a UTSW 7 116340086 missense probably benign 0.06
R9569:Pik3c2a UTSW 7 116358704 missense possibly damaging 0.89
R9758:Pik3c2a UTSW 7 116346192 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGACAACTTGGCGATCTCTCTTC -3'
(R):5'- AGCCCTTCGTTCTCAACACAGC -3'

Sequencing Primer
(F):5'- TGGCGATCTCTCTTCAAGAAGAAC -3'
(R):5'- GTATCTTAGACCTAGTGGTCAAAGAG -3'
Posted On 2014-05-14