Incidental Mutation 'R1711:Olfr971'
ID190581
Institutional Source Beutler Lab
Gene Symbol Olfr971
Ensembl Gene ENSMUSG00000093934
Gene Nameolfactory receptor 971
SynonymsMOR171-13, GA_x6K02T2PVTD-33539896-33540819
MMRRC Submission 039744-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R1711 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location39836876-39841281 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 39840285 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 284 (M284V)
Ref Sequence ENSEMBL: ENSMUSP00000148850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075467] [ENSMUST00000214242]
Predicted Effect probably benign
Transcript: ENSMUST00000075467
AA Change: M284V

PolyPhen 2 Score 0.390 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000074913
Gene: ENSMUSG00000093934
AA Change: M284V

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 2.6e-53 PFAM
Pfam:7tm_1 41 290 9.5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214242
AA Change: M284V

PolyPhen 2 Score 0.390 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 111 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C T 13: 77,269,920 T741I possibly damaging Het
Acot3 A T 12: 84,053,573 Q41L probably damaging Het
Actl7b G A 4: 56,740,165 Q398* probably null Het
Adgrb2 C A 4: 129,992,624 Q186K probably damaging Het
Akr1a1 A G 4: 116,637,974 probably null Het
Ap3s2 A T 7: 79,880,490 F192L probably damaging Het
Apobr T G 7: 126,584,979 probably null Het
Arhgap5 A G 12: 52,519,345 N1033S probably damaging Het
Arid3c G T 4: 41,725,947 R219S probably damaging Het
Bves C T 10: 45,347,865 T207M probably damaging Het
C330027C09Rik A C 16: 49,017,486 I850L probably benign Het
Cacna1d T C 14: 30,066,056 K1619R probably damaging Het
Caps2 A T 10: 112,190,978 D223V possibly damaging Het
Cd163l1 G T 7: 140,220,609 C101F probably damaging Het
Cd3g A C 9: 44,974,342 L35R probably damaging Het
Cdh23 A T 10: 60,523,536 V261E probably benign Het
Cfap54 T G 10: 93,011,020 T1028P possibly damaging Het
Ch25h C A 19: 34,474,286 V281L probably benign Het
Clu G T 14: 65,980,905 V405L possibly damaging Het
Col6a3 A T 1: 90,830,213 H6Q probably damaging Het
Cps1 G A 1: 67,168,374 probably null Het
Ctr9 T C 7: 111,055,663 S1134P unknown Het
Cts7 C T 13: 61,352,810 G308S probably damaging Het
Cyp2c39 C A 19: 39,566,891 T385K probably damaging Het
Dennd5a A T 7: 109,918,712 D596E probably benign Het
Disc1 T A 8: 125,124,610 I413K probably benign Het
Dll3 C T 7: 28,294,497 G505D probably damaging Het
Dnah3 A G 7: 120,078,571 W377R probably damaging Het
Dopey2 A G 16: 93,799,926 D1792G probably damaging Het
Dpep3 T A 8: 105,973,693 R460S probably benign Het
Ebf4 A G 2: 130,358,831 N302S probably damaging Het
Egflam T C 15: 7,289,915 E194G possibly damaging Het
Ep400 A T 5: 110,693,308 probably benign Het
Ercc6 T C 14: 32,526,176 M228T probably damaging Het
Fbxo9 T C 9: 78,087,247 T264A probably damaging Het
Fcrl5 C A 3: 87,457,414 P486T possibly damaging Het
Fyb T C 15: 6,580,479 F178L probably damaging Het
Gaa T A 11: 119,280,460 I646N probably damaging Het
Gm11639 A G 11: 104,720,688 K452R probably benign Het
Gm13124 A T 4: 144,555,406 I272K probably damaging Het
Gm5431 A T 11: 48,895,026 V174E possibly damaging Het
Gnpat T G 8: 124,886,952 probably null Het
Gucy1a2 G T 9: 3,759,622 R476I probably benign Het
Hars A G 18: 36,771,103 L241P probably damaging Het
Haus5 G A 7: 30,657,903 Q399* probably null Het
Hephl1 T C 9: 15,059,246 E984G probably damaging Het
Hmces C T 6: 87,921,592 Q132* probably null Het
Hsp90b1 G T 10: 86,694,525 T490K probably damaging Het
Idh2 T G 7: 80,099,158 E125A probably damaging Het
Ipo13 G T 4: 117,904,522 H465Q probably benign Het
Isca2 C A 12: 84,773,619 T31K probably damaging Het
Itga9 T C 9: 118,698,461 V560A probably benign Het
Jhy G A 9: 40,911,157 Q562* probably null Het
Kcnj5 A G 9: 32,322,569 I150T probably damaging Het
Kmt2a A G 9: 44,841,621 I1419T unknown Het
Lix1 T C 17: 17,446,058 F160L possibly damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Map4k1 A T 7: 28,989,352 Q276L possibly damaging Het
Mmp9 G A 2: 164,949,422 G171S probably damaging Het
Mvp C A 7: 126,995,735 probably null Het
Mylk3 T A 8: 85,364,831 E115V probably damaging Het
Nebl T A 2: 17,388,754 T603S probably damaging Het
Nudt15 T C 14: 73,523,336 D105G probably benign Het
Olfr1369-ps1 G A 13: 21,116,306 V205I probably benign Het
Olfr527 A C 7: 140,335,999 T46P possibly damaging Het
Olfr556 G T 7: 102,670,162 V81L probably damaging Het
Olfr65 T A 7: 103,906,699 W87R probably damaging Het
Olfr685 A T 7: 105,180,760 H199Q probably damaging Het
Osbpl9 A T 4: 109,066,218 C495S probably damaging Het
Pamr1 A G 2: 102,640,852 T507A probably benign Het
Pcdhb9 T A 18: 37,403,327 C791* probably null Het
Pcgf6 T C 19: 47,050,518 E101G probably damaging Het
Pdgfrl A T 8: 40,985,794 I256F probably benign Het
Pdzd7 T C 19: 45,045,511 R45G possibly damaging Het
Pecr C T 1: 72,277,409 V46I possibly damaging Het
Pgr A G 9: 8,922,714 probably null Het
Pik3c2a A T 7: 116,417,927 Y198* probably null Het
Pp2d1 T A 17: 53,515,310 M243L possibly damaging Het
Ppp1r1a T A 15: 103,533,492 I50L possibly damaging Het
Proc T C 18: 32,127,406 D222G probably benign Het
Ptprq T A 10: 107,534,699 R2044* probably null Het
Ranbp2 T C 10: 58,460,519 V326A probably benign Het
Reep6 T A 10: 80,333,981 F122I possibly damaging Het
Rubcn C A 16: 32,843,101 R388S probably damaging Het
Rusc1 A G 3: 89,089,293 L62P probably damaging Het
Satb2 T C 1: 56,850,289 N423S probably damaging Het
Serpinb9d A G 13: 33,200,748 K236R probably benign Het
Slc4a7 A G 14: 14,765,709 R680G probably benign Het
Slitrk1 T A 14: 108,913,096 Y61F probably benign Het
Son A G 16: 91,660,226 probably benign Het
Sparc T A 11: 55,395,776 probably null Het
Spon2 A G 5: 33,216,385 F194S probably damaging Het
Spta1 A G 1: 174,241,042 E2136G probably damaging Het
Stat4 T C 1: 52,106,925 S746P probably damaging Het
Stk31 T A 6: 49,469,304 S958R probably benign Het
Stom T A 2: 35,315,917 I267F probably damaging Het
Stx12 A T 4: 132,858,477 D197E probably damaging Het
Taok3 A T 5: 117,255,926 N588I possibly damaging Het
Tgs1 A G 4: 3,598,658 D657G probably damaging Het
Trim6 A G 7: 104,232,837 T432A probably damaging Het
Trim72 C G 7: 128,004,585 C34W probably damaging Het
Trpc4ap A T 2: 155,657,744 I286N probably benign Het
Ttn A G 2: 76,863,561 V321A possibly damaging Het
Utp4 T A 8: 106,918,720 I583N probably damaging Het
Wdfy2 G T 14: 62,944,097 M225I probably benign Het
Wfdc1 A G 8: 119,681,037 T134A probably benign Het
Wnt9b A G 11: 103,732,128 S150P probably damaging Het
Zbtb46 A T 2: 181,411,684 F412I probably damaging Het
Zc3h15 G A 2: 83,661,148 R240H probably benign Het
Zfp11 A T 5: 129,656,673 Y575N probably benign Het
Zfp687 T C 3: 95,011,889 M191V probably benign Het
Other mutations in Olfr971
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Olfr971 APN 9 39839706 missense probably benign 0.02
IGL00920:Olfr971 APN 9 39839934 missense probably benign
IGL01759:Olfr971 APN 9 39839611 missense probably damaging 0.99
IGL02867:Olfr971 APN 9 39840237 missense probably benign 0.03
IGL02889:Olfr971 APN 9 39840237 missense probably benign 0.03
IGL02900:Olfr971 APN 9 39839812 missense probably damaging 1.00
IGL03333:Olfr971 APN 9 39840012 missense probably damaging 0.98
R0831:Olfr971 UTSW 9 39840283 missense probably damaging 1.00
R1004:Olfr971 UTSW 9 39839980 missense probably benign 0.21
R3900:Olfr971 UTSW 9 39839402 splice site probably null
R4424:Olfr971 UTSW 9 39840356 missense possibly damaging 0.52
R4530:Olfr971 UTSW 9 39840083 missense probably benign
R5385:Olfr971 UTSW 9 39839830 missense possibly damaging 0.95
R5386:Olfr971 UTSW 9 39839830 missense possibly damaging 0.95
R7199:Olfr971 UTSW 9 39839457 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCACTGAATATCTTGACACCTGCATTG -3'
(R):5'- CACTTCTGCTAAAGACACCGACATGAT -3'

Sequencing Primer
(F):5'- TGACACCTGCATTGACCATC -3'
(R):5'- CCCTAATGAATGAATGTACTGCCTC -3'
Posted On2014-05-14