Incidental Mutation 'R1711:Itga9'
ID190586
Institutional Source Beutler Lab
Gene Symbol Itga9
Ensembl Gene ENSMUSG00000039115
Gene Nameintegrin alpha 9
SynonymsD9Ertd428e, 2610002H11Rik, 6720458D17Rik
MMRRC Submission 039744-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1711 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location118606690-118901003 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 118698461 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 560 (V560A)
Ref Sequence ENSEMBL: ENSMUSP00000044227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044165]
Predicted Effect probably benign
Transcript: ENSMUST00000044165
AA Change: V560A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000044227
Gene: ENSMUSG00000039115
AA Change: V560A

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Int_alpha 45 105 8.95e-7 SMART
low complexity region 181 191 N/A INTRINSIC
Int_alpha 244 297 2.12e-8 SMART
Int_alpha 301 356 1.68e-11 SMART
Int_alpha 361 416 2.9e-15 SMART
Int_alpha 423 476 1.11e-2 SMART
SCOP:d1m1xa2 626 766 3e-32 SMART
SCOP:d1m1xa3 769 970 1e-39 SMART
transmembrane domain 981 1003 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125021
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha integrin. Integrins are heterodimeric integral membrane glycoproteins composed of an alpha chain and a beta chain that mediate cell-cell and cell-matrix adhesion. The protein encoded by this gene, when bound to the beta 1 chain, forms an integrin that is a receptor for VCAM1, cytotactin and osteopontin. Expression of this gene has been found to be upregulated in small cell lung cancers. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in respiratory distress leading to postnatal lethality caused by an accumulation of pleural fluid rich in triglyceride, cholesterol and lymphocytes. Mice develop edema and lymphocytic infiltration in the chest wall. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 111 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C T 13: 77,269,920 T741I possibly damaging Het
Acot3 A T 12: 84,053,573 Q41L probably damaging Het
Actl7b G A 4: 56,740,165 Q398* probably null Het
Adgrb2 C A 4: 129,992,624 Q186K probably damaging Het
Akr1a1 A G 4: 116,637,974 probably null Het
Ap3s2 A T 7: 79,880,490 F192L probably damaging Het
Apobr T G 7: 126,584,979 probably null Het
Arhgap5 A G 12: 52,519,345 N1033S probably damaging Het
Arid3c G T 4: 41,725,947 R219S probably damaging Het
Bves C T 10: 45,347,865 T207M probably damaging Het
C330027C09Rik A C 16: 49,017,486 I850L probably benign Het
Cacna1d T C 14: 30,066,056 K1619R probably damaging Het
Caps2 A T 10: 112,190,978 D223V possibly damaging Het
Cd163l1 G T 7: 140,220,609 C101F probably damaging Het
Cd3g A C 9: 44,974,342 L35R probably damaging Het
Cdh23 A T 10: 60,523,536 V261E probably benign Het
Cfap54 T G 10: 93,011,020 T1028P possibly damaging Het
Ch25h C A 19: 34,474,286 V281L probably benign Het
Clu G T 14: 65,980,905 V405L possibly damaging Het
Col6a3 A T 1: 90,830,213 H6Q probably damaging Het
Cps1 G A 1: 67,168,374 probably null Het
Ctr9 T C 7: 111,055,663 S1134P unknown Het
Cts7 C T 13: 61,352,810 G308S probably damaging Het
Cyp2c39 C A 19: 39,566,891 T385K probably damaging Het
Dennd5a A T 7: 109,918,712 D596E probably benign Het
Disc1 T A 8: 125,124,610 I413K probably benign Het
Dll3 C T 7: 28,294,497 G505D probably damaging Het
Dnah3 A G 7: 120,078,571 W377R probably damaging Het
Dopey2 A G 16: 93,799,926 D1792G probably damaging Het
Dpep3 T A 8: 105,973,693 R460S probably benign Het
Ebf4 A G 2: 130,358,831 N302S probably damaging Het
Egflam T C 15: 7,289,915 E194G possibly damaging Het
Ep400 A T 5: 110,693,308 probably benign Het
Ercc6 T C 14: 32,526,176 M228T probably damaging Het
Fbxo9 T C 9: 78,087,247 T264A probably damaging Het
Fcrl5 C A 3: 87,457,414 P486T possibly damaging Het
Fyb T C 15: 6,580,479 F178L probably damaging Het
Gaa T A 11: 119,280,460 I646N probably damaging Het
Gm11639 A G 11: 104,720,688 K452R probably benign Het
Gm13124 A T 4: 144,555,406 I272K probably damaging Het
Gm5431 A T 11: 48,895,026 V174E possibly damaging Het
Gnpat T G 8: 124,886,952 probably null Het
Gucy1a2 G T 9: 3,759,622 R476I probably benign Het
Hars A G 18: 36,771,103 L241P probably damaging Het
Haus5 G A 7: 30,657,903 Q399* probably null Het
Hephl1 T C 9: 15,059,246 E984G probably damaging Het
Hmces C T 6: 87,921,592 Q132* probably null Het
Hsp90b1 G T 10: 86,694,525 T490K probably damaging Het
Idh2 T G 7: 80,099,158 E125A probably damaging Het
Ipo13 G T 4: 117,904,522 H465Q probably benign Het
Isca2 C A 12: 84,773,619 T31K probably damaging Het
Jhy G A 9: 40,911,157 Q562* probably null Het
Kcnj5 A G 9: 32,322,569 I150T probably damaging Het
Kmt2a A G 9: 44,841,621 I1419T unknown Het
Lix1 T C 17: 17,446,058 F160L possibly damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Map4k1 A T 7: 28,989,352 Q276L possibly damaging Het
Mmp9 G A 2: 164,949,422 G171S probably damaging Het
Mvp C A 7: 126,995,735 probably null Het
Mylk3 T A 8: 85,364,831 E115V probably damaging Het
Nebl T A 2: 17,388,754 T603S probably damaging Het
Nudt15 T C 14: 73,523,336 D105G probably benign Het
Olfr1369-ps1 G A 13: 21,116,306 V205I probably benign Het
Olfr527 A C 7: 140,335,999 T46P possibly damaging Het
Olfr556 G T 7: 102,670,162 V81L probably damaging Het
Olfr65 T A 7: 103,906,699 W87R probably damaging Het
Olfr685 A T 7: 105,180,760 H199Q probably damaging Het
Olfr971 A G 9: 39,840,285 M284V probably benign Het
Osbpl9 A T 4: 109,066,218 C495S probably damaging Het
Pamr1 A G 2: 102,640,852 T507A probably benign Het
Pcdhb9 T A 18: 37,403,327 C791* probably null Het
Pcgf6 T C 19: 47,050,518 E101G probably damaging Het
Pdgfrl A T 8: 40,985,794 I256F probably benign Het
Pdzd7 T C 19: 45,045,511 R45G possibly damaging Het
Pecr C T 1: 72,277,409 V46I possibly damaging Het
Pgr A G 9: 8,922,714 probably null Het
Pik3c2a A T 7: 116,417,927 Y198* probably null Het
Pp2d1 T A 17: 53,515,310 M243L possibly damaging Het
Ppp1r1a T A 15: 103,533,492 I50L possibly damaging Het
Proc T C 18: 32,127,406 D222G probably benign Het
Ptprq T A 10: 107,534,699 R2044* probably null Het
Ranbp2 T C 10: 58,460,519 V326A probably benign Het
Reep6 T A 10: 80,333,981 F122I possibly damaging Het
Rubcn C A 16: 32,843,101 R388S probably damaging Het
Rusc1 A G 3: 89,089,293 L62P probably damaging Het
Satb2 T C 1: 56,850,289 N423S probably damaging Het
Serpinb9d A G 13: 33,200,748 K236R probably benign Het
Slc4a7 A G 14: 14,765,709 R680G probably benign Het
Slitrk1 T A 14: 108,913,096 Y61F probably benign Het
Son A G 16: 91,660,226 probably benign Het
Sparc T A 11: 55,395,776 probably null Het
Spon2 A G 5: 33,216,385 F194S probably damaging Het
Spta1 A G 1: 174,241,042 E2136G probably damaging Het
Stat4 T C 1: 52,106,925 S746P probably damaging Het
Stk31 T A 6: 49,469,304 S958R probably benign Het
Stom T A 2: 35,315,917 I267F probably damaging Het
Stx12 A T 4: 132,858,477 D197E probably damaging Het
Taok3 A T 5: 117,255,926 N588I possibly damaging Het
Tgs1 A G 4: 3,598,658 D657G probably damaging Het
Trim6 A G 7: 104,232,837 T432A probably damaging Het
Trim72 C G 7: 128,004,585 C34W probably damaging Het
Trpc4ap A T 2: 155,657,744 I286N probably benign Het
Ttn A G 2: 76,863,561 V321A possibly damaging Het
Utp4 T A 8: 106,918,720 I583N probably damaging Het
Wdfy2 G T 14: 62,944,097 M225I probably benign Het
Wfdc1 A G 8: 119,681,037 T134A probably benign Het
Wnt9b A G 11: 103,732,128 S150P probably damaging Het
Zbtb46 A T 2: 181,411,684 F412I probably damaging Het
Zc3h15 G A 2: 83,661,148 R240H probably benign Het
Zfp11 A T 5: 129,656,673 Y575N probably benign Het
Zfp687 T C 3: 95,011,889 M191V probably benign Het
Other mutations in Itga9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Itga9 APN 9 118769159 start codon destroyed probably null 0.02
IGL01396:Itga9 APN 9 118607123 splice site probably benign
IGL01476:Itga9 APN 9 118607111 missense probably damaging 1.00
IGL01573:Itga9 APN 9 118877230 splice site probably benign
IGL01958:Itga9 APN 9 118636494 splice site probably benign
IGL02060:Itga9 APN 9 118661432 missense probably damaging 1.00
IGL02146:Itga9 APN 9 118834332 missense possibly damaging 0.50
IGL02391:Itga9 APN 9 118850805 missense probably benign 0.19
IGL02947:Itga9 APN 9 118658533 missense probably damaging 1.00
IGL03014:Itga9 UTSW 9 118628144 missense probably benign
R0052:Itga9 UTSW 9 118636549 missense probably damaging 1.00
R0052:Itga9 UTSW 9 118636549 missense probably damaging 1.00
R0142:Itga9 UTSW 9 118636586 missense probably damaging 0.96
R0179:Itga9 UTSW 9 118661386 missense probably benign 0.11
R0207:Itga9 UTSW 9 118769253 splice site probably benign
R0364:Itga9 UTSW 9 118841142 missense probably benign
R0458:Itga9 UTSW 9 118681028 critical splice donor site probably null
R1486:Itga9 UTSW 9 118626450 missense probably damaging 0.98
R1589:Itga9 UTSW 9 118607117 critical splice donor site probably null
R1620:Itga9 UTSW 9 118843502 missense probably benign 0.00
R1721:Itga9 UTSW 9 118698306 splice site probably benign
R2064:Itga9 UTSW 9 118807293 missense probably damaging 0.99
R2201:Itga9 UTSW 9 118877115 splice site probably benign
R2851:Itga9 UTSW 9 118636536 missense probably damaging 0.98
R2853:Itga9 UTSW 9 118636536 missense probably damaging 0.98
R3962:Itga9 UTSW 9 118628186 missense possibly damaging 0.57
R4180:Itga9 UTSW 9 118607078 missense probably damaging 1.00
R4597:Itga9 UTSW 9 118843514 missense probably damaging 1.00
R4716:Itga9 UTSW 9 118681758 missense probably damaging 0.98
R4929:Itga9 UTSW 9 118807249 missense probably damaging 1.00
R5002:Itga9 UTSW 9 118663898 nonsense probably null
R5279:Itga9 UTSW 9 118628205 missense probably damaging 1.00
R5542:Itga9 UTSW 9 118843661 missense possibly damaging 0.86
R5869:Itga9 UTSW 9 118663889 missense probably damaging 1.00
R6372:Itga9 UTSW 9 118897321 missense probably damaging 1.00
R6470:Itga9 UTSW 9 118897267 missense probably damaging 0.99
R6581:Itga9 UTSW 9 118658564 missense probably benign 0.00
R6919:Itga9 UTSW 9 118887815 missense probably damaging 1.00
R7034:Itga9 UTSW 9 118698365 missense probably benign 0.00
R7036:Itga9 UTSW 9 118698365 missense probably benign 0.00
R7043:Itga9 UTSW 9 118769116 missense probably damaging 0.96
R7237:Itga9 UTSW 9 118636602 missense probably benign 0.09
R7491:Itga9 UTSW 9 118769111 missense probably damaging 0.99
R7629:Itga9 UTSW 9 118698446 missense probably benign 0.00
R7774:Itga9 UTSW 9 118871900 missense probably damaging 1.00
R7782:Itga9 UTSW 9 118843644 missense
R7789:Itga9 UTSW 9 118658496 missense possibly damaging 0.80
R7904:Itga9 UTSW 9 118877226 splice site probably null
R8086:Itga9 UTSW 9 118850801 missense probably benign
R8158:Itga9 UTSW 9 118877143 missense probably damaging 0.99
R8204:Itga9 UTSW 9 118871921 missense probably damaging 1.00
Z1176:Itga9 UTSW 9 118843530 missense probably benign 0.00
Z1176:Itga9 UTSW 9 118887839 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCCAGGCAGTTTCCTATACTGTG -3'
(R):5'- AAAGGGACCAGTGCAATGACTCCG -3'

Sequencing Primer
(F):5'- GGCTCAGAGTCTCAACACTCTATG -3'
(R):5'- GCTGAGGTCAATATTCCCAACTG -3'
Posted On2014-05-14