Mutagenetix > Incidental Mutations

Incidental Mutation 'R1711:Gaa'

190601

Institutional Source

Beutler Lab

Gene Symbol

Gaa

Ensembl Gene

ENSMUSG00000025579

Gene Name

glucosidase, alpha, acid

Synonyms

E430018M07Rik

MMRRC Submission

039744-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.518) question?

Stock #

R1711 (G1)

Quality Score

166

Status

Not validated

Chromosome

Chromosomal Location

119267887-119285454 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 119280460 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 646 (I646N)

Ref Sequence

ENSEMBL: ENSMUSP00000101866 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026666] [ENSMUST00000106259] [ENSMUST00000132706]

Predicted Effect

probably damaging
Transcript: ENSMUST00000026666
AA Change: I646N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000026666
Gene: ENSMUSG00000025579
AA Change: I646N

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
PD	80	134	1.08e-15	SMART
Pfam:Gal_mutarotas_2	254	320	3.7e-12	PFAM
Pfam:Glyco_hydro_31	340	825	8.8e-175	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000106259
AA Change: I646N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000101866
Gene: ENSMUSG00000025579
AA Change: I646N

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
PD	80	134	1.08e-15	SMART
Pfam:NtCtMGAM_N	147	253	3.5e-32	PFAM
Pfam:Gal_mutarotas_2	254	320	6.5e-12	PFAM
Pfam:Glyco_hydro_31	340	825	1.8e-153	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000132706

SMART Domains

Protein: ENSMUSP00000119702
Gene: ENSMUSG00000025579

Domain	Start	End	E-Value	Type
Pfam:Glyco_hydro_31	46	269	2.9e-72	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138510

Predicted Effect

unknown
Transcript: ENSMUST00000143288
AA Change: I122N

SMART Domains

Protein: ENSMUSP00000121984
Gene: ENSMUSG00000025579
AA Change: I122N

Domain	Start	End	E-Value	Type
Pfam:Glyco_hydro_31	8	207	2.2e-67	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000150562

SMART Domains

Protein: ENSMUSP00000115128
Gene: ENSMUSG00000025579

Domain	Start	End	E-Value	Type
Pfam:Glyco_hydro_31	1	96	4.3e-28	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.6%
20x: 93.6%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a lysosomal acid glucosidase that is involved in the degradation of glycogen. The encoded preproprotein undergoes proteolytic processing to generate a mature enzyme that cleaves alpha-1-4 and alpha-1-6 glycosidic bonds of glycogen, maltose and intermediate oligosaccharides within the lysosome. Mice lacking the encoded protein exhibit symptoms similar to human Pompe syndrome such as accumulation of glycogen in cardiac and skeletal muscle lysosomes resulting in reduced mobility and strength. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous inactivation of this gene leads to massive glycogen accumulation in multiple organs, cardiomyopathy, hypoactivity, severe motor disability, profound muscle weakness and wasting, and progressive kyphosis. The age of onset and clinical course ofthe disease appear to be strain-dependent. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 111 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	C	T	13: 77,269,920	T741I	possibly damaging	Het
Acot3	A	T	12: 84,053,573	Q41L	probably damaging	Het
Actl7b	G	A	4: 56,740,165	Q398*	probably null	Het
Adgrb2	C	A	4: 129,992,624	Q186K	probably damaging	Het
Akr1a1	A	G	4: 116,637,974		probably null	Het
Ap3s2	A	T	7: 79,880,490	F192L	probably damaging	Het
Apobr	T	G	7: 126,584,979		probably null	Het
Arhgap5	A	G	12: 52,519,345	N1033S	probably damaging	Het
Arid3c	G	T	4: 41,725,947	R219S	probably damaging	Het
Bves	C	T	10: 45,347,865	T207M	probably damaging	Het
C330027C09Rik	A	C	16: 49,017,486	I850L	probably benign	Het
Cacna1d	T	C	14: 30,066,056	K1619R	probably damaging	Het
Caps2	A	T	10: 112,190,978	D223V	possibly damaging	Het
Cd163l1	G	T	7: 140,220,609	C101F	probably damaging	Het
Cd3g	A	C	9: 44,974,342	L35R	probably damaging	Het
Cdh23	A	T	10: 60,523,536	V261E	probably benign	Het
Cfap54	T	G	10: 93,011,020	T1028P	possibly damaging	Het
Ch25h	C	A	19: 34,474,286	V281L	probably benign	Het
Clu	G	T	14: 65,980,905	V405L	possibly damaging	Het
Col6a3	A	T	1: 90,830,213	H6Q	probably damaging	Het
Cps1	G	A	1: 67,168,374		probably null	Het
Ctr9	T	C	7: 111,055,663	S1134P	unknown	Het
Cts7	C	T	13: 61,352,810	G308S	probably damaging	Het
Cyp2c39	C	A	19: 39,566,891	T385K	probably damaging	Het
Dennd5a	A	T	7: 109,918,712	D596E	probably benign	Het
Disc1	T	A	8: 125,124,610	I413K	probably benign	Het
Dll3	C	T	7: 28,294,497	G505D	probably damaging	Het
Dnah3	A	G	7: 120,078,571	W377R	probably damaging	Het
Dopey2	A	G	16: 93,799,926	D1792G	probably damaging	Het
Dpep3	T	A	8: 105,973,693	R460S	probably benign	Het
Ebf4	A	G	2: 130,358,831	N302S	probably damaging	Het
Egflam	T	C	15: 7,289,915	E194G	possibly damaging	Het
Ep400	A	T	5: 110,693,308		probably benign	Het
Ercc6	T	C	14: 32,526,176	M228T	probably damaging	Het
Fbxo9	T	C	9: 78,087,247	T264A	probably damaging	Het
Fcrl5	C	A	3: 87,457,414	P486T	possibly damaging	Het
Fyb	T	C	15: 6,580,479	F178L	probably damaging	Het
Gm11639	A	G	11: 104,720,688	K452R	probably benign	Het
Gm13124	A	T	4: 144,555,406	I272K	probably damaging	Het
Gm5431	A	T	11: 48,895,026	V174E	possibly damaging	Het
Gnpat	T	G	8: 124,886,952		probably null	Het
Gucy1a2	G	T	9: 3,759,622	R476I	probably benign	Het
Hars	A	G	18: 36,771,103	L241P	probably damaging	Het
Haus5	G	A	7: 30,657,903	Q399*	probably null	Het
Hephl1	T	C	9: 15,059,246	E984G	probably damaging	Het
Hmces	C	T	6: 87,921,592	Q132*	probably null	Het
Hsp90b1	G	T	10: 86,694,525	T490K	probably damaging	Het
Idh2	T	G	7: 80,099,158	E125A	probably damaging	Het
Ipo13	G	T	4: 117,904,522	H465Q	probably benign	Het
Isca2	C	A	12: 84,773,619	T31K	probably damaging	Het
Itga9	T	C	9: 118,698,461	V560A	probably benign	Het
Jhy	G	A	9: 40,911,157	Q562*	probably null	Het
Kcnj5	A	G	9: 32,322,569	I150T	probably damaging	Het
Kmt2a	A	G	9: 44,841,621	I1419T	unknown	Het
Lix1	T	C	17: 17,446,058	F160L	possibly damaging	Het
Lonrf2	G	A	1: 38,813,276	P165S	probably benign	Het
Map4k1	A	T	7: 28,989,352	Q276L	possibly damaging	Het
Mmp9	G	A	2: 164,949,422	G171S	probably damaging	Het
Mvp	C	A	7: 126,995,735		probably null	Het
Mylk3	T	A	8: 85,364,831	E115V	probably damaging	Het
Nebl	T	A	2: 17,388,754	T603S	probably damaging	Het
Nudt15	T	C	14: 73,523,336	D105G	probably benign	Het
Olfr1369-ps1	G	A	13: 21,116,306	V205I	probably benign	Het
Olfr527	A	C	7: 140,335,999	T46P	possibly damaging	Het
Olfr556	G	T	7: 102,670,162	V81L	probably damaging	Het
Olfr65	T	A	7: 103,906,699	W87R	probably damaging	Het
Olfr685	A	T	7: 105,180,760	H199Q	probably damaging	Het
Olfr971	A	G	9: 39,840,285	M284V	probably benign	Het
Osbpl9	A	T	4: 109,066,218	C495S	probably damaging	Het
Pamr1	A	G	2: 102,640,852	T507A	probably benign	Het
Pcdhb9	T	A	18: 37,403,327	C791*	probably null	Het
Pcgf6	T	C	19: 47,050,518	E101G	probably damaging	Het
Pdgfrl	A	T	8: 40,985,794	I256F	probably benign	Het
Pdzd7	T	C	19: 45,045,511	R45G	possibly damaging	Het
Pecr	C	T	1: 72,277,409	V46I	possibly damaging	Het
Pgr	A	G	9: 8,922,714		probably null	Het
Pik3c2a	A	T	7: 116,417,927	Y198*	probably null	Het
Pp2d1	T	A	17: 53,515,310	M243L	possibly damaging	Het
Ppp1r1a	T	A	15: 103,533,492	I50L	possibly damaging	Het
Proc	T	C	18: 32,127,406	D222G	probably benign	Het
Ptprq	T	A	10: 107,534,699	R2044*	probably null	Het
Ranbp2	T	C	10: 58,460,519	V326A	probably benign	Het
Reep6	T	A	10: 80,333,981	F122I	possibly damaging	Het
Rubcn	C	A	16: 32,843,101	R388S	probably damaging	Het
Rusc1	A	G	3: 89,089,293	L62P	probably damaging	Het
Satb2	T	C	1: 56,850,289	N423S	probably damaging	Het
Serpinb9d	A	G	13: 33,200,748	K236R	probably benign	Het
Slc4a7	A	G	14: 14,765,709	R680G	probably benign	Het
Slitrk1	T	A	14: 108,913,096	Y61F	probably benign	Het
Son	A	G	16: 91,660,226		probably benign	Het
Sparc	T	A	11: 55,395,776		probably null	Het
Spon2	A	G	5: 33,216,385	F194S	probably damaging	Het
Spta1	A	G	1: 174,241,042	E2136G	probably damaging	Het
Stat4	T	C	1: 52,106,925	S746P	probably damaging	Het
Stk31	T	A	6: 49,469,304	S958R	probably benign	Het
Stom	T	A	2: 35,315,917	I267F	probably damaging	Het
Stx12	A	T	4: 132,858,477	D197E	probably damaging	Het
Taok3	A	T	5: 117,255,926	N588I	possibly damaging	Het
Tgs1	A	G	4: 3,598,658	D657G	probably damaging	Het
Trim6	A	G	7: 104,232,837	T432A	probably damaging	Het
Trim72	C	G	7: 128,004,585	C34W	probably damaging	Het
Trpc4ap	A	T	2: 155,657,744	I286N	probably benign	Het
Ttn	A	G	2: 76,863,561	V321A	possibly damaging	Het
Utp4	T	A	8: 106,918,720	I583N	probably damaging	Het
Wdfy2	G	T	14: 62,944,097	M225I	probably benign	Het
Wfdc1	A	G	8: 119,681,037	T134A	probably benign	Het
Wnt9b	A	G	11: 103,732,128	S150P	probably damaging	Het
Zbtb46	A	T	2: 181,411,684	F412I	probably damaging	Het
Zc3h15	G	A	2: 83,661,148	R240H	probably benign	Het
Zfp11	A	T	5: 129,656,673	Y575N	probably benign	Het
Zfp687	T	C	3: 95,011,889	M191V	probably benign	Het

Other mutations in Gaa

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00325:Gaa	APN	11	119274960	missense	probably benign
IGL00780:Gaa	APN	11	119274291	unclassified	probably null
IGL00975:Gaa	APN	11	119274683	missense	possibly damaging	0.93
IGL01354:Gaa	APN	11	119270568	missense	probably benign	0.18
IGL01572:Gaa	APN	11	119284177	missense	probably benign
IGL01634:Gaa	APN	11	119274076	missense	possibly damaging	0.79
IGL01724:Gaa	APN	11	119275121	missense	possibly damaging	0.65
IGL01889:Gaa	APN	11	119278297	missense	probably benign	0.03
IGL02052:Gaa	APN	11	119284195	missense	possibly damaging	0.76
IGL02173:Gaa	APN	11	119274913	missense	probably damaging	1.00
IGL02261:Gaa	APN	11	119281265	makesense	probably null
IGL02337:Gaa	APN	11	119277603	missense	probably damaging	1.00
IGL02625:Gaa	APN	11	119274733	missense	probably damaging	1.00
IGL02818:Gaa	APN	11	119276848	missense	probably damaging	0.97
R0135:Gaa	UTSW	11	119278890	missense	probably benign	0.00
R0280:Gaa	UTSW	11	119284547	missense	probably damaging	1.00
R0479:Gaa	UTSW	11	119281236	missense	possibly damaging	0.95
R1130:Gaa	UTSW	11	119274683	missense	probably damaging	0.97
R1132:Gaa	UTSW	11	119285059	missense	probably damaging	0.99
R1146:Gaa	UTSW	11	119274904	missense	probably damaging	1.00
R1146:Gaa	UTSW	11	119274904	missense	probably damaging	1.00
R1179:Gaa	UTSW	11	119281128	missense	probably damaging	0.98
R1464:Gaa	UTSW	11	119272984	missense	probably benign	0.02
R1464:Gaa	UTSW	11	119272984	missense	probably benign	0.02
R1475:Gaa	UTSW	11	119274316	splice site	probably null
R1817:Gaa	UTSW	11	119284498	nonsense	probably null
R1828:Gaa	UTSW	11	119283272	missense	probably damaging	0.99
R2013:Gaa	UTSW	11	119284583	unclassified	probably null
R2126:Gaa	UTSW	11	119270282	nonsense	probably null
R2179:Gaa	UTSW	11	119275058	critical splice acceptor site	probably null
R2496:Gaa	UTSW	11	119283705	missense	possibly damaging	0.53
R2936:Gaa	UTSW	11	119283724	missense	probably benign	0.02
R4321:Gaa	UTSW	11	119270137	missense	probably benign	0.20
R4603:Gaa	UTSW	11	119278958	missense	probably damaging	1.00
R4849:Gaa	UTSW	11	119272987	missense	possibly damaging	0.95
R5225:Gaa	UTSW	11	119276843	missense	probably damaging	1.00
R5643:Gaa	UTSW	11	119280535	missense	possibly damaging	0.96
R5644:Gaa	UTSW	11	119280535	missense	possibly damaging	0.96
R6074:Gaa	UTSW	11	119284186	missense	probably benign	0.07
R6154:Gaa	UTSW	11	119278352	missense	probably damaging	1.00
R6208:Gaa	UTSW	11	119281171	missense	probably benign	0.01
R6209:Gaa	UTSW	11	119281171	missense	probably benign	0.01
R6258:Gaa	UTSW	11	119281171	missense	probably benign	0.01
R6259:Gaa	UTSW	11	119281171	missense	probably benign	0.01
R6260:Gaa	UTSW	11	119281171	missense	probably benign	0.01
R7173:Gaa	UTSW	11	119278991	missense	probably damaging	1.00
R7211:Gaa	UTSW	11	119284204	missense	possibly damaging	0.80
R7379:Gaa	UTSW	11	119283699	missense	probably benign
X0064:Gaa	UTSW	11	119274015	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCCACGACATTTTCTTCAGGACCAC -3'
(R):5'- TCCAGCAGGTATGGGATTAACCAGG -3'

Sequencing Primer
(F):5'- TGCCATTACATCTGGAGAGC -3'
(R):5'- TTAACCAGGAGAGGGTCTAGGTG -3'

Posted On

2014-05-14