Incidental Mutation 'R1712:Scn7a'
ID190647
Institutional Source Beutler Lab
Gene Symbol Scn7a
Ensembl Gene ENSMUSG00000034810
Gene Namesodium channel, voltage-gated, type VII, alpha
SynonymsNaG, Nav2, Nav2.3, Nax, Scn6a
MMRRC Submission 039745-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R1712 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location66673425-66784914 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 66705103 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 435 (T435A)
Ref Sequence ENSEMBL: ENSMUSP00000042405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042792]
Predicted Effect probably benign
Transcript: ENSMUST00000042792
AA Change: T435A

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000042405
Gene: ENSMUSG00000034810
AA Change: T435A

DomainStartEndE-ValueType
Pfam:Ion_trans 118 405 4.7e-53 PFAM
coiled coil region 415 443 N/A INTRINSIC
Pfam:Ion_trans 505 739 5.8e-36 PFAM
Pfam:Na_trans_assoc 741 929 4.1e-17 PFAM
Pfam:Ion_trans 933 1204 3e-49 PFAM
Pfam:Ion_trans 1250 1505 5e-37 PFAM
IQ 1624 1646 6.4e-2 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the many voltage-gated sodium channel proteins. For proper functioning of neurons and muscles during action potentials, voltage-gated sodium channels direct sodium ion diffusion for membrane depolarization. This sodium channel protein has some atypical characteristics; the similarity between the human and mouse proteins is lower compared to other orthologous sodium channel pairs. Also, the S4 segments, which sense voltage changes, have fewer positive charged residues that in other sodium channels; domain 4 has fewer arginine and lysine residues compared to other sodium channel proteins. Several alternatively spliced transcript variants exist, but the full-length natures of all of them remain unknown. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene have a modified dietary preference for NaCl but are phenotypically normal otherwise. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Accs T A 2: 93,848,103 E12D probably damaging Het
Ahnak2 C A 12: 112,785,378 R283L probably benign Het
BC005624 T C 2: 30,974,008 E191G probably damaging Het
C1galt1 A G 6: 7,871,217 N351S probably benign Het
Ccdc162 T C 10: 41,539,431 R2179G probably benign Het
Ccdc88c G A 12: 100,939,025 T1108M probably benign Het
Cd47 T C 16: 49,894,180 L184P probably damaging Het
Cdc40 T C 10: 40,841,376 K440E probably damaging Het
Cenpe G A 3: 135,265,933 V2262I probably damaging Het
Cep290 A G 10: 100,554,499 K2035E probably benign Het
Cks1brt G T 8: 85,171,543 L8F probably benign Het
Col17a1 T C 19: 47,649,003 probably benign Het
Coro6 A T 11: 77,469,467 N421I probably benign Het
Cps1 T C 1: 67,230,281 S1480P probably damaging Het
Csrnp3 G T 2: 66,002,482 A110S probably damaging Het
Cyp2d10 G T 15: 82,403,039 T461K probably damaging Het
Dmxl2 A G 9: 54,401,485 V1994A probably benign Het
Dnah11 T A 12: 118,196,644 N117I probably benign Het
Dnajc3 A G 14: 118,957,895 Y74C probably damaging Het
Fam13c T A 10: 70,554,573 F555I possibly damaging Het
Fbn1 T A 2: 125,346,434 D1495V probably damaging Het
Fbrsl1 T C 5: 110,447,996 T58A probably benign Het
Gjc1 A G 11: 102,800,880 I99T possibly damaging Het
Glce T C 9: 62,070,575 N9S probably damaging Het
Gosr1 T C 11: 76,750,878 T125A possibly damaging Het
Ifi27 T A 12: 103,439,943 probably null Het
Jph1 C T 1: 17,097,232 D125N possibly damaging Het
Kbtbd12 A T 6: 88,618,694 S51R probably damaging Het
Klra9 A T 6: 130,189,696 probably null Het
Kmo A T 1: 175,656,723 M340L probably benign Het
Lama1 T C 17: 67,717,186 I93T possibly damaging Het
Limk2 A T 11: 3,358,104 probably null Het
Mgat5 C A 1: 127,320,638 N92K probably benign Het
Mib2 T A 4: 155,654,799 I908F probably damaging Het
Mical1 T G 10: 41,480,363 L304R probably damaging Het
Mtbp G T 15: 55,571,294 probably null Het
Myo3a T C 2: 22,564,992 Y70H probably damaging Het
Neb T C 2: 52,243,389 Y3379C probably damaging Het
Neurod2 G T 11: 98,327,203 N378K probably damaging Het
Olfr1051 T A 2: 86,275,993 T165S probably damaging Het
Olfr117 A G 17: 37,659,908 S142P probably benign Het
Olfr1286 T A 2: 111,420,658 M98L probably benign Het
Olfr986 A G 9: 40,187,865 Y250C probably damaging Het
Oog4 G A 4: 143,439,914 L107F probably damaging Het
Pfdn6 T C 17: 33,939,554 Y82C probably damaging Het
Pla2g4d C A 2: 120,277,490 A313S possibly damaging Het
Ptcd3 C A 6: 71,908,653 E30* probably null Het
Rai1 A G 11: 60,187,602 T831A probably benign Het
Rims1 G A 1: 22,296,948 T1176M probably damaging Het
Rin1 A C 19: 5,055,143 I744L probably benign Het
Rora T A 9: 69,375,489 S430T probably benign Het
Rsph10b T A 5: 143,937,149 S23T probably damaging Het
Ryr1 T C 7: 29,047,503 N3773S probably benign Het
Scn4a A G 11: 106,339,354 Y543H probably damaging Het
Scn4a C A 11: 106,345,547 G296C probably benign Het
Shank2 G T 7: 144,411,153 D833Y probably damaging Het
Slc9a2 T C 1: 40,763,610 S607P possibly damaging Het
Slx4 G A 16: 3,991,594 R346W probably damaging Het
Spata20 A T 11: 94,480,514 C675S probably benign Het
Suclg2 A T 6: 95,587,016 I196N probably damaging Het
Sv2b G A 7: 75,149,059 H272Y possibly damaging Het
Svep1 T C 4: 58,070,629 I2386V probably benign Het
Taf13 A T 3: 108,581,129 E109D possibly damaging Het
Tanc2 A G 11: 105,899,780 T976A probably benign Het
Tax1bp1 A G 6: 52,729,326 Y104C probably damaging Het
Tfeb T C 17: 47,788,986 probably null Het
Tlr9 T C 9: 106,224,049 Y180H probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Ttc12 T A 9: 49,445,199 T510S probably benign Het
Ubqln1 T C 13: 58,192,081 E280G probably damaging Het
Urm1 T C 2: 29,841,425 W44R probably damaging Het
Usp32 A T 11: 85,042,580 I34N probably benign Het
Vars T C 17: 35,014,752 L1018P probably damaging Het
Vcan A T 13: 89,721,775 V206D probably damaging Het
Vim T C 2: 13,578,459 V224A probably damaging Het
Vmn2r106 G T 17: 20,278,735 H305N probably benign Het
Vmn2r78 A G 7: 86,954,924 N770S probably damaging Het
Wdr33 T A 18: 31,896,631 L961Q unknown Het
Xylt2 A G 11: 94,668,749 S356P possibly damaging Het
Zbtb14 A G 17: 69,387,580 N91S probably damaging Het
Zc3h6 T C 2: 129,016,734 L895S probably damaging Het
Zc3h7b C T 15: 81,777,088 P376L probably benign Het
Zfp131 T C 13: 119,766,543 T523A probably benign Het
Other mutations in Scn7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Scn7a APN 2 66683327 splice site probably benign
IGL00432:Scn7a APN 2 66741982 nonsense probably null
IGL00720:Scn7a APN 2 66676044 missense possibly damaging 0.67
IGL00783:Scn7a APN 2 66692564 missense probably damaging 0.99
IGL00784:Scn7a APN 2 66692564 missense probably damaging 0.99
IGL00926:Scn7a APN 2 66684131 missense probably benign 0.06
IGL00963:Scn7a APN 2 66703945 splice site probably benign
IGL01099:Scn7a APN 2 66684238 missense probably damaging 1.00
IGL01326:Scn7a APN 2 66752260 missense probably benign 0.13
IGL01538:Scn7a APN 2 66703852 missense probably benign
IGL01624:Scn7a APN 2 66751925 missense probably benign 0.07
IGL01794:Scn7a APN 2 66675509 missense probably benign
IGL02100:Scn7a APN 2 66675499 makesense probably null
IGL02326:Scn7a APN 2 66700048 missense probably benign 0.00
IGL02472:Scn7a APN 2 66752314 missense probably damaging 1.00
IGL02528:Scn7a APN 2 66700175 missense probably damaging 1.00
IGL02798:Scn7a APN 2 66713875 missense probably benign 0.00
IGL03026:Scn7a APN 2 66676098 missense probably damaging 0.99
IGL03071:Scn7a APN 2 66699947 missense possibly damaging 0.89
IGL03080:Scn7a APN 2 66697816 missense probably benign 0.01
IGL03180:Scn7a APN 2 66676234 missense possibly damaging 0.94
IGL03337:Scn7a APN 2 66675960 missense probably benign 0.00
PIT4514001:Scn7a UTSW 2 66684179 missense probably damaging 1.00
R0004:Scn7a UTSW 2 66687795 missense possibly damaging 0.81
R0076:Scn7a UTSW 2 66714037 missense probably benign 0.04
R0230:Scn7a UTSW 2 66726284 missense probably damaging 1.00
R0463:Scn7a UTSW 2 66675740 missense probably benign 0.05
R0846:Scn7a UTSW 2 66697600 missense possibly damaging 0.71
R1237:Scn7a UTSW 2 66680295 missense probably damaging 0.98
R1282:Scn7a UTSW 2 66700849 missense probably damaging 0.98
R1467:Scn7a UTSW 2 66689558 missense probably benign 0.01
R1467:Scn7a UTSW 2 66689558 missense probably benign 0.01
R1501:Scn7a UTSW 2 66700163 missense probably benign 0.37
R1672:Scn7a UTSW 2 66697600 missense possibly damaging 0.71
R1690:Scn7a UTSW 2 66675943 missense probably damaging 0.99
R1758:Scn7a UTSW 2 66680183 missense probably benign 0.00
R1758:Scn7a UTSW 2 66700887 missense probably damaging 0.97
R1775:Scn7a UTSW 2 66680955 missense probably benign 0.02
R1848:Scn7a UTSW 2 66684013 critical splice donor site probably null
R1851:Scn7a UTSW 2 66680291 missense probably benign
R1919:Scn7a UTSW 2 66699973 missense probably damaging 1.00
R1932:Scn7a UTSW 2 66676102 missense probably damaging 1.00
R1945:Scn7a UTSW 2 66675980 missense probably damaging 1.00
R1970:Scn7a UTSW 2 66684289 missense possibly damaging 0.89
R1998:Scn7a UTSW 2 66683269 missense probably damaging 0.99
R2008:Scn7a UTSW 2 66687747 missense possibly damaging 0.82
R2038:Scn7a UTSW 2 66737436 missense probably damaging 1.00
R2113:Scn7a UTSW 2 66675968 missense probably damaging 1.00
R2128:Scn7a UTSW 2 66697986 missense probably damaging 0.99
R2163:Scn7a UTSW 2 66675956 missense probably damaging 0.97
R2421:Scn7a UTSW 2 66726302 splice site probably benign
R2446:Scn7a UTSW 2 66692658 missense probably damaging 0.98
R2922:Scn7a UTSW 2 66700207 splice site probably benign
R3015:Scn7a UTSW 2 66699896 missense probably benign 0.08
R3034:Scn7a UTSW 2 66682808 missense probably damaging 1.00
R3419:Scn7a UTSW 2 66700895 frame shift probably null
R3429:Scn7a UTSW 2 66700895 frame shift probably null
R3430:Scn7a UTSW 2 66700895 frame shift probably null
R3434:Scn7a UTSW 2 66675503 missense probably benign 0.01
R3803:Scn7a UTSW 2 66680246 nonsense probably null
R3831:Scn7a UTSW 2 66697684 missense probably damaging 0.96
R3833:Scn7a UTSW 2 66697684 missense probably damaging 0.96
R4017:Scn7a UTSW 2 66741985 missense probably damaging 1.00
R4244:Scn7a UTSW 2 66742001 missense probably benign 0.00
R4245:Scn7a UTSW 2 66742001 missense probably benign 0.00
R4276:Scn7a UTSW 2 66684063 missense probably damaging 0.97
R4307:Scn7a UTSW 2 66675755 missense possibly damaging 0.47
R4327:Scn7a UTSW 2 66737471 missense probably damaging 1.00
R4353:Scn7a UTSW 2 66676436 missense probably benign 0.00
R4721:Scn7a UTSW 2 66684185 missense probably damaging 1.00
R4722:Scn7a UTSW 2 66700884 missense possibly damaging 0.95
R4781:Scn7a UTSW 2 66703760 missense possibly damaging 0.95
R4792:Scn7a UTSW 2 66726248 missense probably damaging 1.00
R5362:Scn7a UTSW 2 66699998 missense probably damaging 1.00
R5437:Scn7a UTSW 2 66676346 missense probably damaging 1.00
R5729:Scn7a UTSW 2 66741957 critical splice donor site probably null
R5777:Scn7a UTSW 2 66692569 missense probably damaging 1.00
R5785:Scn7a UTSW 2 66697568 missense possibly damaging 0.79
R5821:Scn7a UTSW 2 66743703 missense probably damaging 0.96
R5830:Scn7a UTSW 2 66714051 nonsense probably null
R5877:Scn7a UTSW 2 66699873 nonsense probably null
R5881:Scn7a UTSW 2 66675526 missense probably benign 0.01
R5967:Scn7a UTSW 2 66675713 missense probably damaging 1.00
R5988:Scn7a UTSW 2 66726214 nonsense probably null
R6077:Scn7a UTSW 2 66697596 missense probably damaging 1.00
R6135:Scn7a UTSW 2 66703900 missense probably benign
R6242:Scn7a UTSW 2 66700766 missense probably benign 0.00
R6264:Scn7a UTSW 2 66675526 missense possibly damaging 0.93
R6291:Scn7a UTSW 2 66700114 missense probably damaging 0.98
R6544:Scn7a UTSW 2 66684100 missense probably damaging 1.00
R6770:Scn7a UTSW 2 66729184 intron probably null
R6997:Scn7a UTSW 2 66703803 missense probably damaging 1.00
R7014:Scn7a UTSW 2 66741959 missense probably null 1.00
R7126:Scn7a UTSW 2 66757286 missense possibly damaging 0.80
R7129:Scn7a UTSW 2 66700193 missense probably benign 0.14
R7176:Scn7a UTSW 2 66676288 missense probably damaging 1.00
R7185:Scn7a UTSW 2 66687795 missense possibly damaging 0.81
R7276:Scn7a UTSW 2 66757162 missense probably damaging 1.00
R7332:Scn7a UTSW 2 66692554 nonsense probably null
R7421:Scn7a UTSW 2 66675532 missense probably benign 0.07
R7488:Scn7a UTSW 2 66757230 missense probably benign 0.16
X0060:Scn7a UTSW 2 66689682 missense probably benign 0.01
X0066:Scn7a UTSW 2 66680192 missense probably benign
Z1088:Scn7a UTSW 2 66713951 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACAACATGCTCCATTGTTGGACACT -3'
(R):5'- CAGCCAATACCATAGGAATGGCAAGT -3'

Sequencing Primer
(F):5'- CTTCCTTAGACTCTAAAAGGACGG -3'
(R):5'- TGATGGAACACAGAAAGCCC -3'
Posted On2014-05-14