Incidental Mutation 'R1712:Cep290'
ID190687
Institutional Source Beutler Lab
Gene Symbol Cep290
Ensembl Gene ENSMUSG00000019971
Gene Namecentrosomal protein 290
Synonymsb2b1454Clo, Nphp6, b2b1752Clo
MMRRC Submission 039745-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.943) question?
Stock #R1712 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location100487558-100574840 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100554499 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 2035 (K2035E)
Ref Sequence ENSEMBL: ENSMUSP00000151388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164751] [ENSMUST00000219765] [ENSMUST00000220346]
Predicted Effect probably benign
Transcript: ENSMUST00000164751
AA Change: K2035E

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000130899
Gene: ENSMUSG00000019971
AA Change: K2035E

DomainStartEndE-ValueType
coiled coil region 59 298 N/A INTRINSIC
coiled coil region 319 566 N/A INTRINSIC
coiled coil region 598 662 N/A INTRINSIC
coiled coil region 697 754 N/A INTRINSIC
coiled coil region 780 875 N/A INTRINSIC
internal_repeat_2 884 894 1.1e-5 PROSPERO
coiled coil region 986 1028 N/A INTRINSIC
internal_repeat_2 1057 1067 1.1e-5 PROSPERO
coiled coil region 1071 1109 N/A INTRINSIC
low complexity region 1140 1156 N/A INTRINSIC
internal_repeat_1 1176 1206 8.72e-8 PROSPERO
coiled coil region 1221 1250 N/A INTRINSIC
Pfam:CEP209_CC5 1290 1417 3.8e-55 PFAM
low complexity region 1476 1493 N/A INTRINSIC
internal_repeat_1 1498 1525 8.72e-8 PROSPERO
coiled coil region 1535 1595 N/A INTRINSIC
coiled coil region 1624 1716 N/A INTRINSIC
coiled coil region 1776 2328 N/A INTRINSIC
low complexity region 2333 2347 N/A INTRINSIC
coiled coil region 2377 2453 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218000
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219643
Predicted Effect probably benign
Transcript: ENSMUST00000219765
AA Change: K2028E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000220346
AA Change: K2035E

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with 13 putative coiled-coil domains, a region with homology to SMC chromosome segregation ATPases, six KID motifs, three tropomyosin homology domains and an ATP/GTP binding site motif A. The protein is localized to the centrosome and cilia and has sites for N-glycosylation, tyrosine sulfation, phosphorylation, N-myristoylation, and amidation. Mutations in this gene have been associated with Joubert syndrome and nephronophthisis and the presence of antibodies against this protein is associated with several forms of cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice display mislocalization of ciliary and phototransduction proteins resulting in early-onset retinal degeneration. Heterotaxy with transposition of the great arteries (TGA), atrioventricular septal defect (AVSD), left bronchial isomerism, and hypoplastic spleen is also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Accs T A 2: 93,848,103 E12D probably damaging Het
Ahnak2 C A 12: 112,785,378 R283L probably benign Het
BC005624 T C 2: 30,974,008 E191G probably damaging Het
C1galt1 A G 6: 7,871,217 N351S probably benign Het
Ccdc162 T C 10: 41,539,431 R2179G probably benign Het
Ccdc88c G A 12: 100,939,025 T1108M probably benign Het
Cd47 T C 16: 49,894,180 L184P probably damaging Het
Cdc40 T C 10: 40,841,376 K440E probably damaging Het
Cenpe G A 3: 135,265,933 V2262I probably damaging Het
Cks1brt G T 8: 85,171,543 L8F probably benign Het
Col17a1 T C 19: 47,649,003 probably benign Het
Coro6 A T 11: 77,469,467 N421I probably benign Het
Cps1 T C 1: 67,230,281 S1480P probably damaging Het
Csrnp3 G T 2: 66,002,482 A110S probably damaging Het
Cyp2d10 G T 15: 82,403,039 T461K probably damaging Het
Dmxl2 A G 9: 54,401,485 V1994A probably benign Het
Dnah11 T A 12: 118,196,644 N117I probably benign Het
Dnajc3 A G 14: 118,957,895 Y74C probably damaging Het
Fam13c T A 10: 70,554,573 F555I possibly damaging Het
Fbn1 T A 2: 125,346,434 D1495V probably damaging Het
Fbrsl1 T C 5: 110,447,996 T58A probably benign Het
Gjc1 A G 11: 102,800,880 I99T possibly damaging Het
Glce T C 9: 62,070,575 N9S probably damaging Het
Gosr1 T C 11: 76,750,878 T125A possibly damaging Het
Ifi27 T A 12: 103,439,943 probably null Het
Jph1 C T 1: 17,097,232 D125N possibly damaging Het
Kbtbd12 A T 6: 88,618,694 S51R probably damaging Het
Klra9 A T 6: 130,189,696 probably null Het
Kmo A T 1: 175,656,723 M340L probably benign Het
Lama1 T C 17: 67,717,186 I93T possibly damaging Het
Limk2 A T 11: 3,358,104 probably null Het
Mgat5 C A 1: 127,320,638 N92K probably benign Het
Mib2 T A 4: 155,654,799 I908F probably damaging Het
Mical1 T G 10: 41,480,363 L304R probably damaging Het
Mtbp G T 15: 55,571,294 probably null Het
Myo3a T C 2: 22,564,992 Y70H probably damaging Het
Neb T C 2: 52,243,389 Y3379C probably damaging Het
Neurod2 G T 11: 98,327,203 N378K probably damaging Het
Olfr1051 T A 2: 86,275,993 T165S probably damaging Het
Olfr117 A G 17: 37,659,908 S142P probably benign Het
Olfr1286 T A 2: 111,420,658 M98L probably benign Het
Olfr986 A G 9: 40,187,865 Y250C probably damaging Het
Oog4 G A 4: 143,439,914 L107F probably damaging Het
Pfdn6 T C 17: 33,939,554 Y82C probably damaging Het
Pla2g4d C A 2: 120,277,490 A313S possibly damaging Het
Ptcd3 C A 6: 71,908,653 E30* probably null Het
Rai1 A G 11: 60,187,602 T831A probably benign Het
Rims1 G A 1: 22,296,948 T1176M probably damaging Het
Rin1 A C 19: 5,055,143 I744L probably benign Het
Rora T A 9: 69,375,489 S430T probably benign Het
Rsph10b T A 5: 143,937,149 S23T probably damaging Het
Ryr1 T C 7: 29,047,503 N3773S probably benign Het
Scn4a A G 11: 106,339,354 Y543H probably damaging Het
Scn4a C A 11: 106,345,547 G296C probably benign Het
Scn7a T C 2: 66,705,103 T435A probably benign Het
Shank2 G T 7: 144,411,153 D833Y probably damaging Het
Slc9a2 T C 1: 40,763,610 S607P possibly damaging Het
Slx4 G A 16: 3,991,594 R346W probably damaging Het
Spata20 A T 11: 94,480,514 C675S probably benign Het
Suclg2 A T 6: 95,587,016 I196N probably damaging Het
Sv2b G A 7: 75,149,059 H272Y possibly damaging Het
Svep1 T C 4: 58,070,629 I2386V probably benign Het
Taf13 A T 3: 108,581,129 E109D possibly damaging Het
Tanc2 A G 11: 105,899,780 T976A probably benign Het
Tax1bp1 A G 6: 52,729,326 Y104C probably damaging Het
Tfeb T C 17: 47,788,986 probably null Het
Tlr9 T C 9: 106,224,049 Y180H probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Ttc12 T A 9: 49,445,199 T510S probably benign Het
Ubqln1 T C 13: 58,192,081 E280G probably damaging Het
Urm1 T C 2: 29,841,425 W44R probably damaging Het
Usp32 A T 11: 85,042,580 I34N probably benign Het
Vars T C 17: 35,014,752 L1018P probably damaging Het
Vcan A T 13: 89,721,775 V206D probably damaging Het
Vim T C 2: 13,578,459 V224A probably damaging Het
Vmn2r106 G T 17: 20,278,735 H305N probably benign Het
Vmn2r78 A G 7: 86,954,924 N770S probably damaging Het
Wdr33 T A 18: 31,896,631 L961Q unknown Het
Xylt2 A G 11: 94,668,749 S356P possibly damaging Het
Zbtb14 A G 17: 69,387,580 N91S probably damaging Het
Zc3h6 T C 2: 129,016,734 L895S probably damaging Het
Zc3h7b C T 15: 81,777,088 P376L probably benign Het
Zfp131 T C 13: 119,766,543 T523A probably benign Het
Other mutations in Cep290
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Cep290 APN 10 100508724 missense probably benign 0.00
IGL00499:Cep290 APN 10 100543327 missense probably damaging 1.00
IGL00547:Cep290 APN 10 100510708 missense probably damaging 0.99
IGL00573:Cep290 APN 10 100540361 missense probably damaging 1.00
IGL00646:Cep290 APN 10 100501154 missense probably benign 0.15
IGL00755:Cep290 APN 10 100531104 missense probably damaging 1.00
IGL00835:Cep290 APN 10 100563380 nonsense probably null
IGL00846:Cep290 APN 10 100540333 splice site probably benign
IGL00985:Cep290 APN 10 100567161 splice site probably benign
IGL01687:Cep290 APN 10 100500205 missense probably damaging 1.00
IGL01782:Cep290 APN 10 100545125 nonsense probably null
IGL02010:Cep290 APN 10 100508707 missense probably benign 0.39
IGL02010:Cep290 APN 10 100561345 missense probably benign 0.00
IGL02036:Cep290 APN 10 100558100 nonsense probably null
IGL02039:Cep290 APN 10 100514602 critical splice donor site probably null
IGL02532:Cep290 APN 10 100545065 missense probably benign 0.04
IGL02950:Cep290 APN 10 100540329 splice site probably benign
IGL03105:Cep290 APN 10 100551824 missense possibly damaging 0.66
IGL03179:Cep290 APN 10 100568088 missense possibly damaging 0.60
IGL03271:Cep290 APN 10 100537801 missense probably benign 0.09
IGL03401:Cep290 APN 10 100500265 missense probably benign 0.27
PIT4687001:Cep290 UTSW 10 100537591 missense probably benign 0.28
R0025:Cep290 UTSW 10 100537831 missense probably damaging 1.00
R0127:Cep290 UTSW 10 100536925 splice site probably benign
R0254:Cep290 UTSW 10 100514574 missense probably benign 0.31
R0295:Cep290 UTSW 10 100537821 missense probably damaging 0.99
R0371:Cep290 UTSW 10 100518564 splice site probably benign
R0390:Cep290 UTSW 10 100508758 missense probably benign 0.09
R0399:Cep290 UTSW 10 100554400 splice site probably benign
R0413:Cep290 UTSW 10 100523314 nonsense probably null
R0427:Cep290 UTSW 10 100516179 missense probably benign 0.01
R0472:Cep290 UTSW 10 100551455 missense probably benign 0.19
R0485:Cep290 UTSW 10 100549344 missense possibly damaging 0.94
R0635:Cep290 UTSW 10 100492676 missense probably damaging 1.00
R0675:Cep290 UTSW 10 100568813 critical splice acceptor site probably null
R0972:Cep290 UTSW 10 100518762 missense probably benign 0.08
R1238:Cep290 UTSW 10 100517863 missense probably damaging 1.00
R1297:Cep290 UTSW 10 100539100 splice site probably benign
R1368:Cep290 UTSW 10 100494966 splice site probably benign
R1394:Cep290 UTSW 10 100537529 missense possibly damaging 0.66
R1437:Cep290 UTSW 10 100572101 missense probably benign 0.00
R1493:Cep290 UTSW 10 100562181 missense probably benign 0.21
R1496:Cep290 UTSW 10 100538966 missense probably damaging 1.00
R1539:Cep290 UTSW 10 100496828 missense probably benign 0.06
R1598:Cep290 UTSW 10 100549329 missense probably damaging 1.00
R1616:Cep290 UTSW 10 100568836 missense probably benign
R1753:Cep290 UTSW 10 100513981 missense probably benign
R1773:Cep290 UTSW 10 100510573 missense probably benign
R1775:Cep290 UTSW 10 100496810 missense probably damaging 0.98
R1799:Cep290 UTSW 10 100516196 missense probably benign 0.00
R1937:Cep290 UTSW 10 100497953 missense possibly damaging 0.71
R1991:Cep290 UTSW 10 100531184 missense possibly damaging 0.80
R2031:Cep290 UTSW 10 100512400 critical splice donor site probably null
R2164:Cep290 UTSW 10 100518795 missense probably damaging 0.96
R2393:Cep290 UTSW 10 100561238 critical splice acceptor site probably null
R2403:Cep290 UTSW 10 100537437 missense probably benign 0.19
R3612:Cep290 UTSW 10 100541581 nonsense probably null
R3800:Cep290 UTSW 10 100572941 missense probably damaging 0.97
R4005:Cep290 UTSW 10 100539008 missense probably damaging 1.00
R4039:Cep290 UTSW 10 100512401 critical splice donor site probably null
R4259:Cep290 UTSW 10 100514492 missense probably damaging 1.00
R4260:Cep290 UTSW 10 100514492 missense probably damaging 1.00
R4319:Cep290 UTSW 10 100539047 missense probably benign 0.09
R4329:Cep290 UTSW 10 100537668 missense probably damaging 0.98
R4573:Cep290 UTSW 10 100518850 missense probably benign
R4614:Cep290 UTSW 10 100508740 missense probably benign
R4614:Cep290 UTSW 10 100559687 missense possibly damaging 0.93
R4708:Cep290 UTSW 10 100523264 missense probably benign 0.02
R4727:Cep290 UTSW 10 100563270 missense probably benign 0.05
R4825:Cep290 UTSW 10 100488348 missense probably damaging 0.96
R4839:Cep290 UTSW 10 100508786 missense probably damaging 0.99
R4858:Cep290 UTSW 10 100494911 missense probably benign 0.31
R4871:Cep290 UTSW 10 100548914 missense probably benign 0.22
R5094:Cep290 UTSW 10 100567030 missense probably damaging 0.97
R5103:Cep290 UTSW 10 100539020 missense probably damaging 1.00
R5499:Cep290 UTSW 10 100537653 missense probably damaging 0.99
R5505:Cep290 UTSW 10 100499186 critical splice donor site probably null
R5615:Cep290 UTSW 10 100531150 missense probably damaging 1.00
R5815:Cep290 UTSW 10 100558108 missense possibly damaging 0.80
R5883:Cep290 UTSW 10 100523399 missense probably benign 0.44
R5889:Cep290 UTSW 10 100499074 missense possibly damaging 0.95
R5928:Cep290 UTSW 10 100551830 missense probably damaging 0.99
R5992:Cep290 UTSW 10 100543321 missense possibly damaging 0.73
R6000:Cep290 UTSW 10 100541787 missense probably damaging 1.00
R6213:Cep290 UTSW 10 100523360 missense probably benign 0.06
R6274:Cep290 UTSW 10 100530207 missense probably damaging 1.00
R6285:Cep290 UTSW 10 100523329 missense probably benign 0.17
R6306:Cep290 UTSW 10 100531166 missense possibly damaging 0.89
R6593:Cep290 UTSW 10 100508776 missense probably benign 0.01
R6649:Cep290 UTSW 10 100518531 missense probably benign 0.28
R6692:Cep290 UTSW 10 100569144 splice site probably null
R6788:Cep290 UTSW 10 100488628 missense probably damaging 1.00
R6847:Cep290 UTSW 10 100563419 missense probably damaging 1.00
R6947:Cep290 UTSW 10 100530056 missense probably damaging 1.00
R7035:Cep290 UTSW 10 100499071 missense probably benign 0.07
R7073:Cep290 UTSW 10 100539003 missense possibly damaging 0.90
R7114:Cep290 UTSW 10 100543358 missense probably damaging 0.98
R7256:Cep290 UTSW 10 100546498 missense probably damaging 1.00
R7258:Cep290 UTSW 10 100499108 missense probably benign 0.01
R7311:Cep290 UTSW 10 100537718 missense probably damaging 0.98
R7505:Cep290 UTSW 10 100516265 missense probably benign 0.01
R7615:Cep290 UTSW 10 100492681 missense probably benign 0.03
R7643:Cep290 UTSW 10 100537553 missense probably benign
R7662:Cep290 UTSW 10 100537803 missense probably benign 0.21
R7663:Cep290 UTSW 10 100554536 critical splice donor site probably null
R7685:Cep290 UTSW 10 100540057 missense probably benign 0.19
R7699:Cep290 UTSW 10 100540369 missense probably benign 0.33
R7717:Cep290 UTSW 10 100492681 missense probably benign 0.03
R7747:Cep290 UTSW 10 100558176 nonsense probably null
R7757:Cep290 UTSW 10 100563434 missense probably benign
R7843:Cep290 UTSW 10 100516188 missense possibly damaging 0.49
R7905:Cep290 UTSW 10 100554490 missense probably benign
R8078:Cep290 UTSW 10 100572887 missense probably benign 0.04
R8081:Cep290 UTSW 10 100558176 nonsense probably null
R8094:Cep290 UTSW 10 100544931 missense possibly damaging 0.95
R8266:Cep290 UTSW 10 100559671 missense probably benign 0.08
R8305:Cep290 UTSW 10 100544934 missense probably benign 0.09
R8325:Cep290 UTSW 10 100517808 missense probably benign 0.03
R8372:Cep290 UTSW 10 100549341 missense probably benign 0.00
R8443:Cep290 UTSW 10 100495844 missense possibly damaging 0.80
R8497:Cep290 UTSW 10 100551458 missense probably damaging 1.00
R8778:Cep290 UTSW 10 100514512 nonsense probably null
Z1176:Cep290 UTSW 10 100549374 critical splice donor site probably benign
Z1177:Cep290 UTSW 10 100497944 missense probably benign
Z1177:Cep290 UTSW 10 100538997 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GGTAGGACCTGTAGCCAGCCAG -3'
(R):5'- TGCAATGAAGGTTAGACAATGCTTGAGG -3'

Sequencing Primer
(F):5'- AATGAAACGTTAGAGTCGTGTTG -3'
(R):5'- TACTGTCCTATCAGACAGGATCAGAG -3'
Posted On2014-05-14