Incidental Mutation 'R1712:Olfr117'
ID190718
Institutional Source Beutler Lab
Gene Symbol Olfr117
Ensembl Gene ENSMUSG00000095286
Gene Nameolfactory receptor 117
SynonymsGA_x6K02T2PSCP-2119438-2118485, MOR256-33
MMRRC Submission 039745-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R1712 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location37657600-37663782 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37659908 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 142 (S142P)
Ref Sequence ENSEMBL: ENSMUSP00000150204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073636] [ENSMUST00000213638] [ENSMUST00000215414]
Predicted Effect probably benign
Transcript: ENSMUST00000073636
AA Change: S142P

PolyPhen 2 Score 0.421 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000073320
Gene: ENSMUSG00000095286
AA Change: S142P

DomainStartEndE-ValueType
Pfam:7tm_4 29 307 2.7e-44 PFAM
Pfam:7TM_GPCR_Srsx 34 222 2e-5 PFAM
Pfam:7tm_1 40 289 2.9e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213638
AA Change: S142P

PolyPhen 2 Score 0.421 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000215414
AA Change: S142P

PolyPhen 2 Score 0.421 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Accs T A 2: 93,848,103 E12D probably damaging Het
Ahnak2 C A 12: 112,785,378 R283L probably benign Het
BC005624 T C 2: 30,974,008 E191G probably damaging Het
C1galt1 A G 6: 7,871,217 N351S probably benign Het
Ccdc162 T C 10: 41,539,431 R2179G probably benign Het
Ccdc88c G A 12: 100,939,025 T1108M probably benign Het
Cd47 T C 16: 49,894,180 L184P probably damaging Het
Cdc40 T C 10: 40,841,376 K440E probably damaging Het
Cenpe G A 3: 135,265,933 V2262I probably damaging Het
Cep290 A G 10: 100,554,499 K2035E probably benign Het
Cks1brt G T 8: 85,171,543 L8F probably benign Het
Col17a1 T C 19: 47,649,003 probably benign Het
Coro6 A T 11: 77,469,467 N421I probably benign Het
Cps1 T C 1: 67,230,281 S1480P probably damaging Het
Csrnp3 G T 2: 66,002,482 A110S probably damaging Het
Cyp2d10 G T 15: 82,403,039 T461K probably damaging Het
Dmxl2 A G 9: 54,401,485 V1994A probably benign Het
Dnah11 T A 12: 118,196,644 N117I probably benign Het
Dnajc3 A G 14: 118,957,895 Y74C probably damaging Het
Fam13c T A 10: 70,554,573 F555I possibly damaging Het
Fbn1 T A 2: 125,346,434 D1495V probably damaging Het
Fbrsl1 T C 5: 110,447,996 T58A probably benign Het
Gjc1 A G 11: 102,800,880 I99T possibly damaging Het
Glce T C 9: 62,070,575 N9S probably damaging Het
Gosr1 T C 11: 76,750,878 T125A possibly damaging Het
Ifi27 T A 12: 103,439,943 probably null Het
Jph1 C T 1: 17,097,232 D125N possibly damaging Het
Kbtbd12 A T 6: 88,618,694 S51R probably damaging Het
Klra9 A T 6: 130,189,696 probably null Het
Kmo A T 1: 175,656,723 M340L probably benign Het
Lama1 T C 17: 67,717,186 I93T possibly damaging Het
Limk2 A T 11: 3,358,104 probably null Het
Mgat5 C A 1: 127,320,638 N92K probably benign Het
Mib2 T A 4: 155,654,799 I908F probably damaging Het
Mical1 T G 10: 41,480,363 L304R probably damaging Het
Mtbp G T 15: 55,571,294 probably null Het
Myo3a T C 2: 22,564,992 Y70H probably damaging Het
Neb T C 2: 52,243,389 Y3379C probably damaging Het
Neurod2 G T 11: 98,327,203 N378K probably damaging Het
Olfr1051 T A 2: 86,275,993 T165S probably damaging Het
Olfr1286 T A 2: 111,420,658 M98L probably benign Het
Olfr986 A G 9: 40,187,865 Y250C probably damaging Het
Oog4 G A 4: 143,439,914 L107F probably damaging Het
Pfdn6 T C 17: 33,939,554 Y82C probably damaging Het
Pla2g4d C A 2: 120,277,490 A313S possibly damaging Het
Ptcd3 C A 6: 71,908,653 E30* probably null Het
Rai1 A G 11: 60,187,602 T831A probably benign Het
Rims1 G A 1: 22,296,948 T1176M probably damaging Het
Rin1 A C 19: 5,055,143 I744L probably benign Het
Rora T A 9: 69,375,489 S430T probably benign Het
Rsph10b T A 5: 143,937,149 S23T probably damaging Het
Ryr1 T C 7: 29,047,503 N3773S probably benign Het
Scn4a A G 11: 106,339,354 Y543H probably damaging Het
Scn4a C A 11: 106,345,547 G296C probably benign Het
Scn7a T C 2: 66,705,103 T435A probably benign Het
Shank2 G T 7: 144,411,153 D833Y probably damaging Het
Slc9a2 T C 1: 40,763,610 S607P possibly damaging Het
Slx4 G A 16: 3,991,594 R346W probably damaging Het
Spata20 A T 11: 94,480,514 C675S probably benign Het
Suclg2 A T 6: 95,587,016 I196N probably damaging Het
Sv2b G A 7: 75,149,059 H272Y possibly damaging Het
Svep1 T C 4: 58,070,629 I2386V probably benign Het
Taf13 A T 3: 108,581,129 E109D possibly damaging Het
Tanc2 A G 11: 105,899,780 T976A probably benign Het
Tax1bp1 A G 6: 52,729,326 Y104C probably damaging Het
Tfeb T C 17: 47,788,986 probably null Het
Tlr9 T C 9: 106,224,049 Y180H probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Ttc12 T A 9: 49,445,199 T510S probably benign Het
Ubqln1 T C 13: 58,192,081 E280G probably damaging Het
Urm1 T C 2: 29,841,425 W44R probably damaging Het
Usp32 A T 11: 85,042,580 I34N probably benign Het
Vars T C 17: 35,014,752 L1018P probably damaging Het
Vcan A T 13: 89,721,775 V206D probably damaging Het
Vim T C 2: 13,578,459 V224A probably damaging Het
Vmn2r106 G T 17: 20,278,735 H305N probably benign Het
Vmn2r78 A G 7: 86,954,924 N770S probably damaging Het
Wdr33 T A 18: 31,896,631 L961Q unknown Het
Xylt2 A G 11: 94,668,749 S356P possibly damaging Het
Zbtb14 A G 17: 69,387,580 N91S probably damaging Het
Zc3h6 T C 2: 129,016,734 L895S probably damaging Het
Zc3h7b C T 15: 81,777,088 P376L probably benign Het
Zfp131 T C 13: 119,766,543 T523A probably benign Het
Other mutations in Olfr117
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01862:Olfr117 APN 17 37659477 missense probably damaging 1.00
IGL01949:Olfr117 APN 17 37659466 missense probably damaging 1.00
IGL02085:Olfr117 APN 17 37659688 missense probably benign 0.11
IGL02481:Olfr117 APN 17 37659472 missense probably damaging 1.00
IGL02483:Olfr117 APN 17 37659472 missense probably damaging 1.00
IGL03274:Olfr117 APN 17 37659755 missense probably benign 0.35
R0234:Olfr117 UTSW 17 37660106 missense probably damaging 0.99
R0234:Olfr117 UTSW 17 37660106 missense probably damaging 0.99
R1522:Olfr117 UTSW 17 37659770 missense probably damaging 1.00
R1750:Olfr117 UTSW 17 37659673 missense probably damaging 1.00
R1865:Olfr117 UTSW 17 37659863 missense possibly damaging 0.78
R2371:Olfr117 UTSW 17 37660153 missense probably damaging 1.00
R2382:Olfr117 UTSW 17 37659931 missense probably benign 0.00
R3798:Olfr117 UTSW 17 37660106 missense probably damaging 0.99
R4831:Olfr117 UTSW 17 37660078 missense probably benign 0.03
R5087:Olfr117 UTSW 17 37659721 missense probably damaging 0.97
R5365:Olfr117 UTSW 17 37659695 missense probably damaging 1.00
R5812:Olfr117 UTSW 17 37659739 missense probably damaging 1.00
R5822:Olfr117 UTSW 17 37660231 missense probably damaging 1.00
R6405:Olfr117 UTSW 17 37660123 missense possibly damaging 0.58
R6945:Olfr117 UTSW 17 37659514 missense possibly damaging 0.95
R7121:Olfr117 UTSW 17 37659808 missense probably damaging 0.98
R7312:Olfr117 UTSW 17 37659512 missense possibly damaging 0.78
R7502:Olfr117 UTSW 17 37660231 missense probably damaging 1.00
R8116:Olfr117 UTSW 17 37659740 missense probably damaging 1.00
R8425:Olfr117 UTSW 17 37660084 missense probably damaging 1.00
RF017:Olfr117 UTSW 17 37659781 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTGAGATCCACAGGTTCCAAGAG -3'
(R):5'- TGGTCCAGCCAAGACAATTACTGC -3'

Sequencing Primer
(F):5'- GCTTTACCCCAGGTTAGAGCTG -3'
(R):5'- TGCCACAGGCTGTGCTATAC -3'
Posted On2014-05-14