Incidental Mutation 'R1713:Akap9'
ID190759
Institutional Source Beutler Lab
Gene Symbol Akap9
Ensembl Gene ENSMUSG00000040407
Gene NameA kinase (PRKA) anchor protein (yotiao) 9
SynonymsAKAP450, G1-448-15, 5730481H23Rik, mei2-5, repro12
MMRRC Submission 039746-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.432) question?
Stock #R1713 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location3928054-4081310 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 4039345 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000046129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044492]
Predicted Effect probably null
Transcript: ENSMUST00000044492
SMART Domains Protein: ENSMUSP00000046129
Gene: ENSMUSG00000040407

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
low complexity region 98 115 N/A INTRINSIC
Blast:HPT 126 197 6e-21 BLAST
low complexity region 237 249 N/A INTRINSIC
low complexity region 297 315 N/A INTRINSIC
coiled coil region 404 593 N/A INTRINSIC
coiled coil region 622 756 N/A INTRINSIC
coiled coil region 777 843 N/A INTRINSIC
coiled coil region 888 958 N/A INTRINSIC
low complexity region 982 997 N/A INTRINSIC
coiled coil region 1037 1065 N/A INTRINSIC
low complexity region 1233 1246 N/A INTRINSIC
internal_repeat_2 1247 1312 7.75e-5 PROSPERO
internal_repeat_1 1377 1485 2.63e-5 PROSPERO
coiled coil region 1522 1589 N/A INTRINSIC
coiled coil region 1789 2107 N/A INTRINSIC
coiled coil region 2132 2318 N/A INTRINSIC
internal_repeat_1 2322 2445 2.63e-5 PROSPERO
coiled coil region 2455 2494 N/A INTRINSIC
low complexity region 2587 2598 N/A INTRINSIC
low complexity region 2627 2640 N/A INTRINSIC
internal_repeat_2 2934 2997 7.75e-5 PROSPERO
low complexity region 3000 3016 N/A INTRINSIC
coiled coil region 3109 3307 N/A INTRINSIC
coiled coil region 3455 3493 N/A INTRINSIC
coiled coil region 3521 3556 N/A INTRINSIC
Pfam:PACT_coil_coil 3576 3657 1.2e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196350
Meta Mutation Damage Score 0.9493 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 98% (96/98)
MGI Phenotype PHENOTYPE: Mice homozygous for a chemically induced allele exhibit male infertily with abnormal spermatogenesis and Sertoli maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik T A 4: 103,270,767 I54F possibly damaging Het
Ackr1 A T 1: 173,332,349 H134Q probably benign Het
Agtr1b A T 3: 20,316,309 F44L probably benign Het
Ahnak G A 19: 9,011,809 D3486N possibly damaging Het
Anks6 T A 4: 47,039,726 Q495L probably benign Het
Arpp21 A G 9: 112,067,169 S684P probably damaging Het
Ash1l A G 3: 89,076,224 E2911G probably damaging Het
Avpi1 C T 19: 42,124,809 E70K probably damaging Het
Btbd17 G T 11: 114,795,824 P9T probably benign Het
C4b A G 17: 34,729,271 probably benign Het
Carm1 T C 9: 21,586,489 V385A probably damaging Het
Casd1 A G 6: 4,624,104 D299G probably damaging Het
Clca1 T A 3: 145,024,546 K179N probably benign Het
Col1a2 T C 6: 4,538,691 S1204P unknown Het
Col24a1 C T 3: 145,366,869 Q780* probably null Het
Cxadr C A 16: 78,334,245 N216K probably damaging Het
Daam1 C T 12: 71,895,882 T40I unknown Het
Dab2 C T 15: 6,429,701 P365S possibly damaging Het
Dnah1 A T 14: 31,279,182 I2402N probably damaging Het
Dscaml1 T A 9: 45,752,690 S1954R possibly damaging Het
Dync2h1 T C 9: 7,131,891 T1639A probably benign Het
Ebf1 A T 11: 44,924,566 I336F probably damaging Het
Ebna1bp2 A G 4: 118,625,684 N290S possibly damaging Het
Gabra2 A G 5: 71,014,563 I110T probably benign Het
Galk2 A G 2: 125,931,290 N203S probably benign Het
Gria4 T C 9: 4,424,448 T806A probably benign Het
Impg2 A G 16: 56,260,526 T789A probably benign Het
Itga6 A G 2: 71,787,202 T22A probably benign Het
Itgb4 T A 11: 116,003,489 I1312N probably damaging Het
Kdm4c A G 4: 74,298,484 D160G probably benign Het
Kdr A G 5: 75,968,467 V173A probably benign Het
Kif14 T C 1: 136,527,464 S1575P probably benign Het
Lcp1 G A 14: 75,199,444 probably null Het
Lipe C A 7: 25,385,325 S516I probably damaging Het
Lrrc61 G A 6: 48,568,774 R177Q possibly damaging Het
Macf1 A G 4: 123,378,694 I6429T probably damaging Het
Map3k4 C T 17: 12,249,571 E1012K probably benign Het
Map3k5 T C 10: 20,110,847 F936L possibly damaging Het
Mllt3 A T 4: 87,783,664 N497K probably damaging Het
Moxd1 G A 10: 24,281,496 G342D probably damaging Het
Mtdh A C 15: 34,114,839 Q202H possibly damaging Het
Nav1 A G 1: 135,595,234 probably benign Het
Nop56 T C 2: 130,277,966 V109A possibly damaging Het
Obscn T C 11: 59,079,886 D2540G probably damaging Het
Olfr1121 A T 2: 87,371,946 Y138F probably damaging Het
Olfr1495 A T 19: 13,769,295 T318S probably benign Het
Omg T C 11: 79,502,853 I60V probably benign Het
Osbpl5 G A 7: 143,694,373 H652Y probably damaging Het
Papd7 A T 13: 69,503,051 I565N probably benign Het
Parvb T C 15: 84,297,991 probably benign Het
Pcdhb3 A C 18: 37,303,322 E780D probably benign Het
Pik3c3 A G 18: 30,323,586 D723G possibly damaging Het
Prkdc T C 16: 15,795,094 V3172A probably benign Het
Psme4 G T 11: 30,806,310 W272L probably damaging Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Rhobtb1 A C 10: 69,272,771 S434R probably benign Het
Rhobtb1 G C 10: 69,272,772 S434T possibly damaging Het
Rnf8 T C 17: 29,634,761 F413S probably damaging Het
Rpn2 A G 2: 157,314,968 N497S probably damaging Het
Rsbn1l G T 5: 20,951,490 P99Q probably benign Het
Serpinb3b A T 1: 107,155,434 M246K probably benign Het
Sgsm2 T C 11: 74,896,826 E19G probably null Het
Shank1 A G 7: 44,319,737 H352R unknown Het
Slc17a7 A G 7: 45,170,304 I177V probably benign Het
Slc28a2 T A 2: 122,451,013 F228I probably damaging Het
Slc35b4 C T 6: 34,170,549 V35I probably benign Het
Slc38a1 T C 15: 96,578,760 I407V probably damaging Het
Slc39a13 A G 2: 91,063,097 V326A probably damaging Het
Slc44a5 T C 3: 154,239,106 L120P probably damaging Het
Slfn3 T C 11: 83,213,314 I214T probably damaging Het
Slitrk3 A C 3: 73,049,691 S583A probably benign Het
Snx14 T C 9: 88,415,675 Y180C probably damaging Het
Sorl1 T A 9: 41,996,242 K1483I probably benign Het
Ssrp1 C A 2: 85,040,760 H247N probably damaging Het
Stk39 A T 2: 68,307,116 probably benign Het
Syde1 C T 10: 78,585,696 G674R probably damaging Het
Themis3 G A 17: 66,555,853 S370L probably benign Het
Tll1 T A 8: 64,101,873 N259Y probably damaging Het
Tnip2 T G 5: 34,503,831 probably benign Het
Top2b T C 14: 16,409,823 V830A probably benign Het
Trpm8 T A 1: 88,365,080 N934K probably damaging Het
Ttc14 A G 3: 33,802,920 Y179C probably damaging Het
Ttn T G 2: 76,743,621 I17316L possibly damaging Het
Tufm T C 7: 126,487,699 V52A probably benign Het
Vamp8 T A 6: 72,388,287 N20I probably benign Het
Vmn1r170 A T 7: 23,606,863 H230L probably benign Het
Vmn2r50 T G 7: 10,037,804 T657P probably damaging Het
Xirp2 G A 2: 67,512,418 G1668R probably benign Het
Zik1 C A 7: 10,490,384 R262L possibly damaging Het
Zscan25 T G 5: 145,283,691 Y99D probably damaging Het
Other mutations in Akap9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Akap9 APN 5 4046639 missense probably damaging 0.97
IGL00642:Akap9 APN 5 3960842 missense probably damaging 0.99
IGL00786:Akap9 APN 5 4070522 missense probably damaging 1.00
IGL00788:Akap9 APN 5 4060480 missense probably damaging 1.00
IGL00969:Akap9 APN 5 4001550 missense probably benign
IGL01014:Akap9 APN 5 3968683 missense probably benign 0.41
IGL01302:Akap9 APN 5 3970711 missense probably benign 0.27
IGL01610:Akap9 APN 5 4032839 missense possibly damaging 0.95
IGL01620:Akap9 APN 5 3960218 missense probably benign 0.11
IGL01862:Akap9 APN 5 3951705 missense probably damaging 0.99
IGL01862:Akap9 APN 5 4065856 missense probably damaging 0.99
IGL02151:Akap9 APN 5 4032728 nonsense probably null
IGL02635:Akap9 APN 5 4070500 missense possibly damaging 0.59
IGL02858:Akap9 APN 5 4069130 missense possibly damaging 0.88
IGL02967:Akap9 APN 5 3976164 missense probably benign 0.07
IGL03064:Akap9 APN 5 3968755 missense probably damaging 1.00
IGL03289:Akap9 APN 5 4077261 missense probably damaging 1.00
wee_one UTSW 5 4043925 missense probably damaging 1.00
FR4449:Akap9 UTSW 5 3981214 unclassified probably benign
PIT1430001:Akap9 UTSW 5 4029849 missense probably damaging 1.00
PIT4366001:Akap9 UTSW 5 4046221 missense probably benign 0.24
R0088:Akap9 UTSW 5 3961946 missense probably benign 0.22
R0309:Akap9 UTSW 5 4069038 missense probably benign 0.01
R0387:Akap9 UTSW 5 3951678 splice site probably benign
R0440:Akap9 UTSW 5 4064569 missense probably damaging 0.99
R0441:Akap9 UTSW 5 3961714 missense probably benign 0.15
R0491:Akap9 UTSW 5 3972851 unclassified probably benign
R0501:Akap9 UTSW 5 3970685 missense probably damaging 1.00
R0507:Akap9 UTSW 5 4069043 missense probably benign 0.41
R0544:Akap9 UTSW 5 4069185 missense probably benign 0.22
R0581:Akap9 UTSW 5 4050620 missense probably benign 0.03
R0611:Akap9 UTSW 5 3954870 missense probably benign 0.00
R0620:Akap9 UTSW 5 4064136 missense probably damaging 0.98
R0639:Akap9 UTSW 5 4060318 missense probably damaging 1.00
R0932:Akap9 UTSW 5 4046492 missense possibly damaging 0.77
R0944:Akap9 UTSW 5 4064742 synonymous probably null
R1101:Akap9 UTSW 5 4046205 missense probably benign 0.00
R1159:Akap9 UTSW 5 3960865 missense probably damaging 0.98
R1170:Akap9 UTSW 5 4055671 missense probably benign
R1185:Akap9 UTSW 5 3948783 missense probably benign 0.13
R1185:Akap9 UTSW 5 3948783 missense probably benign 0.13
R1185:Akap9 UTSW 5 3948783 missense probably benign 0.13
R1453:Akap9 UTSW 5 3975614 unclassified probably null
R1551:Akap9 UTSW 5 4069174 missense probably benign 0.02
R1608:Akap9 UTSW 5 3961783 missense probably damaging 1.00
R1652:Akap9 UTSW 5 4077210 missense probably damaging 1.00
R1659:Akap9 UTSW 5 4064633 missense probably damaging 1.00
R1719:Akap9 UTSW 5 3957645 nonsense probably null
R1720:Akap9 UTSW 5 3972791 missense possibly damaging 0.63
R1757:Akap9 UTSW 5 4001667 missense probably benign 0.41
R1872:Akap9 UTSW 5 4001406 missense probably damaging 1.00
R1876:Akap9 UTSW 5 3961809 missense probably benign 0.28
R1881:Akap9 UTSW 5 4050173 missense probably benign
R1950:Akap9 UTSW 5 3960677 missense probably damaging 1.00
R1980:Akap9 UTSW 5 3972771 missense probably damaging 0.99
R1993:Akap9 UTSW 5 4038520 splice site probably null
R2008:Akap9 UTSW 5 3960131 missense possibly damaging 0.47
R2020:Akap9 UTSW 5 3961967 missense probably damaging 1.00
R2051:Akap9 UTSW 5 3975685 nonsense probably null
R2061:Akap9 UTSW 5 3961010 missense probably damaging 1.00
R2109:Akap9 UTSW 5 4044847 missense possibly damaging 0.47
R2135:Akap9 UTSW 5 4064509 missense probably damaging 1.00
R2225:Akap9 UTSW 5 4077271 missense probably damaging 0.96
R2232:Akap9 UTSW 5 4046603 missense probably damaging 1.00
R2424:Akap9 UTSW 5 4065279 missense probably damaging 0.97
R2483:Akap9 UTSW 5 3976235 missense possibly damaging 0.65
R2879:Akap9 UTSW 5 3976353 intron probably benign
R3622:Akap9 UTSW 5 3976235 missense possibly damaging 0.65
R3623:Akap9 UTSW 5 3976235 missense possibly damaging 0.65
R3624:Akap9 UTSW 5 3976235 missense possibly damaging 0.65
R3722:Akap9 UTSW 5 4070351 missense probably damaging 1.00
R3806:Akap9 UTSW 5 3954410 missense probably benign 0.00
R3919:Akap9 UTSW 5 3961764 nonsense probably null
R4023:Akap9 UTSW 5 3992077 missense possibly damaging 0.66
R4093:Akap9 UTSW 5 4043996 missense probably damaging 0.99
R4434:Akap9 UTSW 5 4032708 missense probably damaging 0.99
R4529:Akap9 UTSW 5 4043948 missense probably damaging 1.00
R4530:Akap9 UTSW 5 4043948 missense probably damaging 1.00
R4532:Akap9 UTSW 5 4043948 missense probably damaging 1.00
R4533:Akap9 UTSW 5 4043948 missense probably damaging 1.00
R4585:Akap9 UTSW 5 3976151 missense probably benign 0.00
R4586:Akap9 UTSW 5 3976151 missense probably benign 0.00
R4655:Akap9 UTSW 5 4046403 missense probably benign 0.14
R4676:Akap9 UTSW 5 4032774 missense probably damaging 1.00
R4676:Akap9 UTSW 5 4064515 nonsense probably null
R4724:Akap9 UTSW 5 4055339 missense probably benign
R4731:Akap9 UTSW 5 3962266 missense possibly damaging 0.54
R4732:Akap9 UTSW 5 4013901 missense probably damaging 0.98
R4733:Akap9 UTSW 5 4013901 missense probably damaging 0.98
R4743:Akap9 UTSW 5 3961013 missense probably damaging 1.00
R4749:Akap9 UTSW 5 3968737 missense probably benign 0.41
R4756:Akap9 UTSW 5 4001418 missense probably damaging 0.99
R4757:Akap9 UTSW 5 4008382 missense probably damaging 1.00
R4860:Akap9 UTSW 5 4034916 intron probably benign
R4937:Akap9 UTSW 5 4050145 splice site probably null
R4960:Akap9 UTSW 5 3957664 missense probably benign 0.15
R4974:Akap9 UTSW 5 3961466 missense possibly damaging 0.81
R5101:Akap9 UTSW 5 4001748 missense probably damaging 0.96
R5160:Akap9 UTSW 5 4030007 missense probably damaging 1.00
R5200:Akap9 UTSW 5 3960734 missense probably benign 0.00
R5245:Akap9 UTSW 5 3976209 missense probably damaging 0.99
R5293:Akap9 UTSW 5 3948687 missense probably damaging 0.99
R5408:Akap9 UTSW 5 4058458 missense possibly damaging 0.84
R5507:Akap9 UTSW 5 3968683 missense probably benign 0.41
R5517:Akap9 UTSW 5 4001665 missense possibly damaging 0.76
R5579:Akap9 UTSW 5 4064714 missense possibly damaging 0.93
R5619:Akap9 UTSW 5 3954760 intron probably benign
R5645:Akap9 UTSW 5 4050590 missense probably benign 0.09
R5669:Akap9 UTSW 5 4050540 nonsense probably null
R5686:Akap9 UTSW 5 3971926 missense probably benign 0.00
R5697:Akap9 UTSW 5 3960170 missense possibly damaging 0.92
R5821:Akap9 UTSW 5 4046064 missense probably benign 0.13
R5875:Akap9 UTSW 5 4077285 missense probably benign 0.01
R5897:Akap9 UTSW 5 4077904 missense probably benign 0.23
R5999:Akap9 UTSW 5 4043925 missense probably damaging 1.00
R6025:Akap9 UTSW 5 4032801 missense probably damaging 1.00
R6078:Akap9 UTSW 5 4067924 critical splice donor site probably null
R6138:Akap9 UTSW 5 4067924 critical splice donor site probably null
R6225:Akap9 UTSW 5 3962105 missense probably damaging 1.00
R6243:Akap9 UTSW 5 4065000 intron probably null
R6326:Akap9 UTSW 5 3962061 missense probably damaging 1.00
R6564:Akap9 UTSW 5 4028491 missense probably damaging 0.98
R6617:Akap9 UTSW 5 3968745 missense probably benign 0.04
R6625:Akap9 UTSW 5 3968745 missense probably benign 0.04
R6632:Akap9 UTSW 5 4013842 splice site probably null
R6677:Akap9 UTSW 5 4029869 missense probably benign 0.21
R6717:Akap9 UTSW 5 4064086 missense probably damaging 1.00
R6893:Akap9 UTSW 5 3961709 missense probably benign 0.32
R6915:Akap9 UTSW 5 3960551 missense probably benign 0.03
R6938:Akap9 UTSW 5 4046628 missense possibly damaging 0.91
R6972:Akap9 UTSW 5 4046699 missense possibly damaging 0.62
R6973:Akap9 UTSW 5 4046699 missense possibly damaging 0.62
R6993:Akap9 UTSW 5 4065866 missense possibly damaging 0.65
R7032:Akap9 UTSW 5 3954896 missense probably benign
R7164:Akap9 UTSW 5 4060364 missense probably damaging 0.96
R7170:Akap9 UTSW 5 3968745 missense probably benign 0.04
R7192:Akap9 UTSW 5 4005723 intron probably null
R7284:Akap9 UTSW 5 3956246 missense probably damaging 1.00
R7299:Akap9 UTSW 5 4032696 missense probably damaging 1.00
R7313:Akap9 UTSW 5 4004933 missense probably damaging 1.00
R7326:Akap9 UTSW 5 4045930 missense possibly damaging 0.47
R7343:Akap9 UTSW 5 4046364 missense probably damaging 0.99
R7455:Akap9 UTSW 5 3972792 missense probably benign 0.03
R7482:Akap9 UTSW 5 3968745 missense probably benign 0.04
R7489:Akap9 UTSW 5 4004933 missense probably damaging 1.00
R7525:Akap9 UTSW 5 3968745 missense probably benign 0.04
R7528:Akap9 UTSW 5 3968745 missense probably benign 0.04
R7576:Akap9 UTSW 5 3968745 missense probably benign 0.04
R7577:Akap9 UTSW 5 3968745 missense probably benign 0.04
R7578:Akap9 UTSW 5 3968745 missense probably benign 0.04
R7610:Akap9 UTSW 5 3957677 missense possibly damaging 0.95
R7658:Akap9 UTSW 5 3968745 missense probably benign 0.04
R7754:Akap9 UTSW 5 4046736 missense probably benign 0.03
R7818:Akap9 UTSW 5 4013875 nonsense probably null
U15987:Akap9 UTSW 5 4067924 critical splice donor site probably null
X0026:Akap9 UTSW 5 4014039 missense probably damaging 1.00
X0057:Akap9 UTSW 5 3975598 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ATTAGATGCAGCGAAGCCCGTTCC -3'
(R):5'- ACCAGCTCGTGGTTCAGTTCTGAC -3'

Sequencing Primer
(F):5'- TTCTCCAGAAAACCAGAATGGATAG -3'
(R):5'- CCTTCAAGGTCAATCTTCAAGC -3'
Posted On2014-05-14