Incidental Mutation 'R1713:Psme4'
ID 190794
Institutional Source Beutler Lab
Gene Symbol Psme4
Ensembl Gene ENSMUSG00000040850
Gene Name proteasome (prosome, macropain) activator subunit 4
Synonyms
MMRRC Submission 039746-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1713 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 30721726-30830361 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 30756310 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Leucine at position 272 (W272L)
Ref Sequence ENSEMBL: ENSMUSP00000045460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041231]
AlphaFold Q5SSW2
Predicted Effect probably damaging
Transcript: ENSMUST00000041231
AA Change: W272L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045460
Gene: ENSMUSG00000040850
AA Change: W272L

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 122 133 N/A INTRINSIC
Pfam:BLM10_mid 330 828 8.8e-119 PFAM
SCOP:d1b3ua_ 1183 1716 3e-14 SMART
Pfam:DUF3437 1756 1843 5.3e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154757
SMART Domains Protein: ENSMUSP00000119133
Gene: ENSMUSG00000040850

DomainStartEndE-ValueType
low complexity region 131 142 N/A INTRINSIC
Meta Mutation Damage Score 0.9318 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 98% (96/98)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele show normal repair of DNA double-strand breaks but exhibit significantly reduced male fertility due to defects in spermatogenesis observed in both meiotic spermatocytes and postmeiotic haploid spermatids. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted, knock-out(1) Gene trapped(24)

Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik T A 4: 103,127,964 (GRCm39) I54F possibly damaging Het
Ackr1 A T 1: 173,159,916 (GRCm39) H134Q probably benign Het
Agtr1b A T 3: 20,370,473 (GRCm39) F44L probably benign Het
Ahnak G A 19: 8,989,173 (GRCm39) D3486N possibly damaging Het
Akap9 T C 5: 4,089,345 (GRCm39) probably null Het
Anks6 T A 4: 47,039,726 (GRCm39) Q495L probably benign Het
Arpp21 A G 9: 111,896,237 (GRCm39) S684P probably damaging Het
Ash1l A G 3: 88,983,531 (GRCm39) E2911G probably damaging Het
Avpi1 C T 19: 42,113,248 (GRCm39) E70K probably damaging Het
Btbd17 G T 11: 114,686,650 (GRCm39) P9T probably benign Het
C4b A G 17: 34,948,245 (GRCm39) probably benign Het
Carm1 T C 9: 21,497,785 (GRCm39) V385A probably damaging Het
Casd1 A G 6: 4,624,104 (GRCm39) D299G probably damaging Het
Clca3a1 T A 3: 144,730,307 (GRCm39) K179N probably benign Het
Col1a2 T C 6: 4,538,691 (GRCm39) S1204P unknown Het
Col24a1 C T 3: 145,072,624 (GRCm39) Q780* probably null Het
Cxadr C A 16: 78,131,133 (GRCm39) N216K probably damaging Het
Daam1 C T 12: 71,942,656 (GRCm39) T40I unknown Het
Dab2 C T 15: 6,459,182 (GRCm39) P365S possibly damaging Het
Dnah1 A T 14: 31,001,139 (GRCm39) I2402N probably damaging Het
Dscaml1 T A 9: 45,663,988 (GRCm39) S1954R possibly damaging Het
Dync2h1 T C 9: 7,131,891 (GRCm39) T1639A probably benign Het
Ebf1 A T 11: 44,815,393 (GRCm39) I336F probably damaging Het
Ebna1bp2 A G 4: 118,482,881 (GRCm39) N290S possibly damaging Het
Gabra2 A G 5: 71,171,906 (GRCm39) I110T probably benign Het
Galk2 A G 2: 125,773,210 (GRCm39) N203S probably benign Het
Gria4 T C 9: 4,424,448 (GRCm39) T806A probably benign Het
Impg2 A G 16: 56,080,889 (GRCm39) T789A probably benign Het
Itga6 A G 2: 71,617,546 (GRCm39) T22A probably benign Het
Itgb4 T A 11: 115,894,315 (GRCm39) I1312N probably damaging Het
Kdm4c A G 4: 74,216,721 (GRCm39) D160G probably benign Het
Kdr A G 5: 76,129,127 (GRCm39) V173A probably benign Het
Kif14 T C 1: 136,455,202 (GRCm39) S1575P probably benign Het
Lcp1 G A 14: 75,436,884 (GRCm39) probably null Het
Lipe C A 7: 25,084,750 (GRCm39) S516I probably damaging Het
Lrrc61 G A 6: 48,545,708 (GRCm39) R177Q possibly damaging Het
Macf1 A G 4: 123,272,487 (GRCm39) I6429T probably damaging Het
Map3k4 C T 17: 12,468,458 (GRCm39) E1012K probably benign Het
Map3k5 T C 10: 19,986,593 (GRCm39) F936L possibly damaging Het
Mllt3 A T 4: 87,701,901 (GRCm39) N497K probably damaging Het
Moxd1 G A 10: 24,157,394 (GRCm39) G342D probably damaging Het
Mtdh A C 15: 34,114,985 (GRCm39) Q202H possibly damaging Het
Nav1 A G 1: 135,522,972 (GRCm39) probably benign Het
Nop56 T C 2: 130,119,886 (GRCm39) V109A possibly damaging Het
Obscn T C 11: 58,970,712 (GRCm39) D2540G probably damaging Het
Omg T C 11: 79,393,679 (GRCm39) I60V probably benign Het
Or10q12 A T 19: 13,746,659 (GRCm39) T318S probably benign Het
Or12e9 A T 2: 87,202,290 (GRCm39) Y138F probably damaging Het
Osbpl5 G A 7: 143,248,110 (GRCm39) H652Y probably damaging Het
Parvb T C 15: 84,182,192 (GRCm39) probably benign Het
Pcdhb3 A C 18: 37,436,375 (GRCm39) E780D probably benign Het
Pik3c3 A G 18: 30,456,639 (GRCm39) D723G possibly damaging Het
Prkdc T C 16: 15,612,958 (GRCm39) V3172A probably benign Het
Rem1 G A 2: 152,476,455 (GRCm39) V238M probably damaging Het
Rhobtb1 A C 10: 69,108,601 (GRCm39) S434R probably benign Het
Rhobtb1 G C 10: 69,108,602 (GRCm39) S434T possibly damaging Het
Rnf8 T C 17: 29,853,735 (GRCm39) F413S probably damaging Het
Rpn2 A G 2: 157,156,888 (GRCm39) N497S probably damaging Het
Rsbn1l G T 5: 21,156,488 (GRCm39) P99Q probably benign Het
Serpinb3b A T 1: 107,083,164 (GRCm39) M246K probably benign Het
Sgsm2 T C 11: 74,787,652 (GRCm39) E19G probably null Het
Shank1 A G 7: 43,969,161 (GRCm39) H352R unknown Het
Slc17a7 A G 7: 44,819,728 (GRCm39) I177V probably benign Het
Slc28a2 T A 2: 122,281,494 (GRCm39) F228I probably damaging Het
Slc35b4 C T 6: 34,147,484 (GRCm39) V35I probably benign Het
Slc38a1 T C 15: 96,476,641 (GRCm39) I407V probably damaging Het
Slc39a13 A G 2: 90,893,442 (GRCm39) V326A probably damaging Het
Slc44a5 T C 3: 153,944,743 (GRCm39) L120P probably damaging Het
Slfn3 T C 11: 83,104,140 (GRCm39) I214T probably damaging Het
Slitrk3 A C 3: 72,957,024 (GRCm39) S583A probably benign Het
Snx14 T C 9: 88,297,728 (GRCm39) Y180C probably damaging Het
Sorl1 T A 9: 41,907,538 (GRCm39) K1483I probably benign Het
Ssrp1 C A 2: 84,871,104 (GRCm39) H247N probably damaging Het
Stk39 A T 2: 68,137,460 (GRCm39) probably benign Het
Syde1 C T 10: 78,421,530 (GRCm39) G674R probably damaging Het
Tent4a A T 13: 69,651,170 (GRCm39) I565N probably benign Het
Themis3 G A 17: 66,862,848 (GRCm39) S370L probably benign Het
Tll1 T A 8: 64,554,907 (GRCm39) N259Y probably damaging Het
Tnip2 T G 5: 34,661,175 (GRCm39) probably benign Het
Top2b T C 14: 16,409,823 (GRCm38) V830A probably benign Het
Trpm8 T A 1: 88,292,802 (GRCm39) N934K probably damaging Het
Ttc14 A G 3: 33,857,069 (GRCm39) Y179C probably damaging Het
Ttn T G 2: 76,573,965 (GRCm39) I17316L possibly damaging Het
Tufm T C 7: 126,086,871 (GRCm39) V52A probably benign Het
Vamp8 T A 6: 72,365,270 (GRCm39) N20I probably benign Het
Vmn1r170 A T 7: 23,306,288 (GRCm39) H230L probably benign Het
Vmn2r50 T G 7: 9,771,731 (GRCm39) T657P probably damaging Het
Xirp2 G A 2: 67,342,762 (GRCm39) G1668R probably benign Het
Zik1 C A 7: 10,224,311 (GRCm39) R262L possibly damaging Het
Zscan25 T G 5: 145,220,501 (GRCm39) Y99D probably damaging Het
Other mutations in Psme4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Psme4 APN 11 30,765,710 (GRCm39) critical splice donor site probably null
IGL00401:Psme4 APN 11 30,771,079 (GRCm39) splice site probably benign
IGL00475:Psme4 APN 11 30,795,252 (GRCm39) missense probably benign 0.14
IGL00576:Psme4 APN 11 30,773,145 (GRCm39) missense possibly damaging 0.50
IGL00817:Psme4 APN 11 30,770,129 (GRCm39) missense probably benign 0.01
IGL01525:Psme4 APN 11 30,759,936 (GRCm39) splice site probably benign
IGL01862:Psme4 APN 11 30,762,038 (GRCm39) nonsense probably null
IGL02310:Psme4 APN 11 30,787,484 (GRCm39) missense probably benign 0.06
IGL02477:Psme4 APN 11 30,792,083 (GRCm39) missense probably damaging 0.99
IGL02545:Psme4 APN 11 30,791,586 (GRCm39) missense possibly damaging 0.81
IGL02608:Psme4 APN 11 30,770,944 (GRCm39) missense probably benign 0.34
IGL02621:Psme4 APN 11 30,798,131 (GRCm39) missense probably benign
IGL02822:Psme4 APN 11 30,798,204 (GRCm39) unclassified probably benign
IGL02833:Psme4 APN 11 30,800,715 (GRCm39) unclassified probably benign
IGL02964:Psme4 APN 11 30,741,095 (GRCm39) nonsense probably null
IGL03273:Psme4 APN 11 30,798,130 (GRCm39) missense probably damaging 1.00
IGL03348:Psme4 APN 11 30,826,796 (GRCm39) missense probably damaging 1.00
IGL03382:Psme4 APN 11 30,757,788 (GRCm39) missense possibly damaging 0.94
H2330:Psme4 UTSW 11 30,801,210 (GRCm39) missense probably benign 0.17
PIT4378001:Psme4 UTSW 11 30,771,079 (GRCm39) splice site probably benign
R0276:Psme4 UTSW 11 30,761,980 (GRCm39) missense probably damaging 1.00
R0462:Psme4 UTSW 11 30,798,117 (GRCm39) missense probably damaging 1.00
R0685:Psme4 UTSW 11 30,828,415 (GRCm39) missense probably damaging 1.00
R0766:Psme4 UTSW 11 30,757,687 (GRCm39) splice site probably null
R0830:Psme4 UTSW 11 30,757,797 (GRCm39) missense possibly damaging 0.53
R0940:Psme4 UTSW 11 30,765,264 (GRCm39) missense possibly damaging 0.53
R1018:Psme4 UTSW 11 30,754,310 (GRCm39) missense probably damaging 1.00
R1312:Psme4 UTSW 11 30,757,687 (GRCm39) splice site probably null
R1448:Psme4 UTSW 11 30,802,744 (GRCm39) missense probably damaging 1.00
R1732:Psme4 UTSW 11 30,798,105 (GRCm39) missense probably benign 0.03
R1813:Psme4 UTSW 11 30,754,353 (GRCm39) missense probably benign 0.14
R1905:Psme4 UTSW 11 30,760,922 (GRCm39) missense probably damaging 1.00
R1907:Psme4 UTSW 11 30,760,922 (GRCm39) missense probably damaging 1.00
R1911:Psme4 UTSW 11 30,765,658 (GRCm39) missense probably benign 0.02
R1956:Psme4 UTSW 11 30,782,424 (GRCm39) missense probably damaging 0.99
R1974:Psme4 UTSW 11 30,769,011 (GRCm39) missense probably benign 0.00
R1980:Psme4 UTSW 11 30,782,615 (GRCm39) missense possibly damaging 0.84
R1986:Psme4 UTSW 11 30,780,352 (GRCm39) missense probably benign 0.01
R2046:Psme4 UTSW 11 30,767,723 (GRCm39) splice site probably benign
R2142:Psme4 UTSW 11 30,770,998 (GRCm39) missense possibly damaging 0.89
R2698:Psme4 UTSW 11 30,824,282 (GRCm39) critical splice donor site probably null
R2844:Psme4 UTSW 11 30,795,173 (GRCm39) splice site probably benign
R3807:Psme4 UTSW 11 30,806,027 (GRCm39) splice site probably null
R3876:Psme4 UTSW 11 30,806,068 (GRCm39) missense probably damaging 0.99
R4420:Psme4 UTSW 11 30,762,028 (GRCm39) missense possibly damaging 0.67
R4584:Psme4 UTSW 11 30,784,318 (GRCm39) missense probably damaging 1.00
R4615:Psme4 UTSW 11 30,784,287 (GRCm39) missense probably benign 0.02
R4714:Psme4 UTSW 11 30,782,573 (GRCm39) missense probably benign 0.02
R5008:Psme4 UTSW 11 30,806,896 (GRCm39) intron probably benign
R5109:Psme4 UTSW 11 30,741,095 (GRCm39) nonsense probably null
R5155:Psme4 UTSW 11 30,826,806 (GRCm39) missense probably damaging 1.00
R5199:Psme4 UTSW 11 30,803,272 (GRCm39) missense probably benign 0.00
R5205:Psme4 UTSW 11 30,782,666 (GRCm39) intron probably benign
R5452:Psme4 UTSW 11 30,741,168 (GRCm39) missense probably benign
R5491:Psme4 UTSW 11 30,765,246 (GRCm39) missense possibly damaging 0.63
R5685:Psme4 UTSW 11 30,759,837 (GRCm39) missense probably damaging 0.99
R5764:Psme4 UTSW 11 30,722,364 (GRCm39) intron probably benign
R5853:Psme4 UTSW 11 30,741,234 (GRCm39) critical splice donor site probably null
R5865:Psme4 UTSW 11 30,741,993 (GRCm39) missense possibly damaging 0.95
R5903:Psme4 UTSW 11 30,791,589 (GRCm39) missense probably benign 0.28
R5927:Psme4 UTSW 11 30,754,294 (GRCm39) missense possibly damaging 0.82
R6004:Psme4 UTSW 11 30,806,896 (GRCm39) intron probably benign
R6102:Psme4 UTSW 11 30,815,567 (GRCm39) missense probably damaging 1.00
R6247:Psme4 UTSW 11 30,803,245 (GRCm39) missense possibly damaging 0.60
R6527:Psme4 UTSW 11 30,782,175 (GRCm39) missense probably benign
R6750:Psme4 UTSW 11 30,803,203 (GRCm39) missense probably damaging 1.00
R6885:Psme4 UTSW 11 30,784,307 (GRCm39) nonsense probably null
R6939:Psme4 UTSW 11 30,787,291 (GRCm39) missense probably damaging 0.99
R6945:Psme4 UTSW 11 30,787,437 (GRCm39) missense probably benign 0.06
R7029:Psme4 UTSW 11 30,722,474 (GRCm39) intron probably benign
R7049:Psme4 UTSW 11 30,763,904 (GRCm39) splice site probably null
R7098:Psme4 UTSW 11 30,800,661 (GRCm39) missense probably damaging 0.99
R7107:Psme4 UTSW 11 30,798,105 (GRCm39) missense probably benign 0.03
R7223:Psme4 UTSW 11 30,824,226 (GRCm39) missense probably benign 0.33
R7319:Psme4 UTSW 11 30,757,790 (GRCm39) missense probably benign 0.00
R7375:Psme4 UTSW 11 30,722,700 (GRCm39) splice site probably null
R7410:Psme4 UTSW 11 30,765,279 (GRCm39) nonsense probably null
R7469:Psme4 UTSW 11 30,752,837 (GRCm39) missense probably benign 0.20
R7651:Psme4 UTSW 11 30,787,334 (GRCm39) missense probably damaging 0.98
R7679:Psme4 UTSW 11 30,828,425 (GRCm39) missense probably damaging 0.99
R7681:Psme4 UTSW 11 30,741,975 (GRCm39) missense possibly damaging 0.63
R7822:Psme4 UTSW 11 30,824,245 (GRCm39) missense probably benign
R8013:Psme4 UTSW 11 30,754,320 (GRCm39) missense probably benign 0.06
R8130:Psme4 UTSW 11 30,792,026 (GRCm39) missense probably damaging 1.00
R8323:Psme4 UTSW 11 30,793,532 (GRCm39) missense probably damaging 0.99
R8330:Psme4 UTSW 11 30,793,583 (GRCm39) missense probably benign 0.00
R8363:Psme4 UTSW 11 30,762,139 (GRCm39) missense probably damaging 1.00
R8491:Psme4 UTSW 11 30,722,161 (GRCm39) missense possibly damaging 0.90
R8690:Psme4 UTSW 11 30,787,319 (GRCm39) missense probably benign 0.00
R8696:Psme4 UTSW 11 30,759,896 (GRCm39) missense probably damaging 0.99
R8743:Psme4 UTSW 11 30,828,467 (GRCm39) missense probably damaging 1.00
R8998:Psme4 UTSW 11 30,788,957 (GRCm39) missense possibly damaging 0.78
R9241:Psme4 UTSW 11 30,815,576 (GRCm39) missense probably damaging 1.00
R9657:Psme4 UTSW 11 30,788,980 (GRCm39) missense probably benign 0.00
R9736:Psme4 UTSW 11 30,797,411 (GRCm39) missense probably damaging 0.99
R9744:Psme4 UTSW 11 30,765,294 (GRCm39) critical splice donor site probably null
R9746:Psme4 UTSW 11 30,826,868 (GRCm39) nonsense probably null
V5088:Psme4 UTSW 11 30,801,210 (GRCm39) missense probably benign 0.17
X0063:Psme4 UTSW 11 30,782,600 (GRCm39) missense possibly damaging 0.66
Z1176:Psme4 UTSW 11 30,793,522 (GRCm39) missense possibly damaging 0.87
Z1177:Psme4 UTSW 11 30,762,138 (GRCm39) missense probably damaging 1.00
Z1177:Psme4 UTSW 11 30,756,311 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATTGTTCTAAGGATTGCTGAAAGGGA -3'
(R):5'- GGGGAGTGGGTAACACTCTAGAATGC -3'

Sequencing Primer
(F):5'- gcacgcactcgcaatcc -3'
(R):5'- CAGACAACTCTTTGAAAGGAATGAAC -3'
Posted On 2014-05-14