Mutagenetix > Incidental Mutation

Incidental Mutation 'R1713:Psme4'

190794

Institutional Source

Beutler Lab

Gene Symbol

Psme4

Ensembl Gene

ENSMUSG00000040850

Gene Name

proteasome (prosome, macropain) activator subunit 4

Synonyms

MMRRC Submission

039746-MU

Accession Numbers

Genbank: NM_134013

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1713 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

30771726-30880361 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 30806310 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Leucine at position 272 (W272L)

Ref Sequence

ENSEMBL: ENSMUSP00000045460 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041231]

AlphaFold

Q5SSW2

Predicted Effect

probably damaging
Transcript: ENSMUST00000041231
AA Change: W272L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000045460
Gene: ENSMUSG00000040850
AA Change: W272L

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	122	133	N/A	INTRINSIC
Pfam:BLM10_mid	330	828	8.8e-119	PFAM
SCOP:d1b3ua_	1183	1716	3e-14	SMART
Pfam:DUF3437	1756	1843	5.3e-39	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000154757

SMART Domains

Protein: ENSMUSP00000119133
Gene: ENSMUSG00000040850

Domain	Start	End	E-Value	Type
low complexity region	131	142	N/A	INTRINSIC

Meta Mutation Damage Score

0.9318

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.7%
20x: 93.6%

Validation Efficiency

98% (96/98)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele show normal repair of DNA double-strand breaks but exhibit significantly reduced male fertility due to defects in spermatogenesis observed in both meiotic spermatocytes and postmeiotic haploid spermatids. [provided by MGI curators]

Allele List at MGI

All alleles(25) : Targeted, knock-out(1) Gene trapped(24)

Other mutations in this stock

Total: 90 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921539E11Rik	T	A	4: 103,270,767	I54F	possibly damaging	Het
Ackr1	A	T	1: 173,332,349	H134Q	probably benign	Het
Agtr1b	A	T	3: 20,316,309	F44L	probably benign	Het
Ahnak	G	A	19: 9,011,809	D3486N	possibly damaging	Het
Akap9	T	C	5: 4,039,345		probably null	Het
Anks6	T	A	4: 47,039,726	Q495L	probably benign	Het
Arpp21	A	G	9: 112,067,169	S684P	probably damaging	Het
Ash1l	A	G	3: 89,076,224	E2911G	probably damaging	Het
Avpi1	C	T	19: 42,124,809	E70K	probably damaging	Het
Btbd17	G	T	11: 114,795,824	P9T	probably benign	Het
C4b	A	G	17: 34,729,271		probably benign	Het
Carm1	T	C	9: 21,586,489	V385A	probably damaging	Het
Casd1	A	G	6: 4,624,104	D299G	probably damaging	Het
Clca1	T	A	3: 145,024,546	K179N	probably benign	Het
Col1a2	T	C	6: 4,538,691	S1204P	unknown	Het
Col24a1	C	T	3: 145,366,869	Q780*	probably null	Het
Cxadr	C	A	16: 78,334,245	N216K	probably damaging	Het
Daam1	C	T	12: 71,895,882	T40I	unknown	Het
Dab2	C	T	15: 6,429,701	P365S	possibly damaging	Het
Dnah1	A	T	14: 31,279,182	I2402N	probably damaging	Het
Dscaml1	T	A	9: 45,752,690	S1954R	possibly damaging	Het
Dync2h1	T	C	9: 7,131,891	T1639A	probably benign	Het
Ebf1	A	T	11: 44,924,566	I336F	probably damaging	Het
Ebna1bp2	A	G	4: 118,625,684	N290S	possibly damaging	Het
Gabra2	A	G	5: 71,014,563	I110T	probably benign	Het
Galk2	A	G	2: 125,931,290	N203S	probably benign	Het
Gria4	T	C	9: 4,424,448	T806A	probably benign	Het
Impg2	A	G	16: 56,260,526	T789A	probably benign	Het
Itga6	A	G	2: 71,787,202	T22A	probably benign	Het
Itgb4	T	A	11: 116,003,489	I1312N	probably damaging	Het
Kdm4c	A	G	4: 74,298,484	D160G	probably benign	Het
Kdr	A	G	5: 75,968,467	V173A	probably benign	Het
Kif14	T	C	1: 136,527,464	S1575P	probably benign	Het
Lcp1	G	A	14: 75,199,444		probably null	Het
Lipe	C	A	7: 25,385,325	S516I	probably damaging	Het
Lrrc61	G	A	6: 48,568,774	R177Q	possibly damaging	Het
Macf1	A	G	4: 123,378,694	I6429T	probably damaging	Het
Map3k4	C	T	17: 12,249,571	E1012K	probably benign	Het
Map3k5	T	C	10: 20,110,847	F936L	possibly damaging	Het
Mllt3	A	T	4: 87,783,664	N497K	probably damaging	Het
Moxd1	G	A	10: 24,281,496	G342D	probably damaging	Het
Mtdh	A	C	15: 34,114,839	Q202H	possibly damaging	Het
Nav1	A	G	1: 135,595,234		probably benign	Het
Nop56	T	C	2: 130,277,966	V109A	possibly damaging	Het
Obscn	T	C	11: 59,079,886	D2540G	probably damaging	Het
Olfr1121	A	T	2: 87,371,946	Y138F	probably damaging	Het
Olfr1495	A	T	19: 13,769,295	T318S	probably benign	Het
Omg	T	C	11: 79,502,853	I60V	probably benign	Het
Osbpl5	G	A	7: 143,694,373	H652Y	probably damaging	Het
Papd7	A	T	13: 69,503,051	I565N	probably benign	Het
Parvb	T	C	15: 84,297,991		probably benign	Het
Pcdhb3	A	C	18: 37,303,322	E780D	probably benign	Het
Pik3c3	A	G	18: 30,323,586	D723G	possibly damaging	Het
Prkdc	T	C	16: 15,795,094	V3172A	probably benign	Het
Rem1	G	A	2: 152,634,535	V238M	probably damaging	Het
Rhobtb1	A	C	10: 69,272,771	S434R	probably benign	Het
Rhobtb1	G	C	10: 69,272,772	S434T	possibly damaging	Het
Rnf8	T	C	17: 29,634,761	F413S	probably damaging	Het
Rpn2	A	G	2: 157,314,968	N497S	probably damaging	Het
Rsbn1l	G	T	5: 20,951,490	P99Q	probably benign	Het
Serpinb3b	A	T	1: 107,155,434	M246K	probably benign	Het
Sgsm2	T	C	11: 74,896,826	E19G	probably null	Het
Shank1	A	G	7: 44,319,737	H352R	unknown	Het
Slc17a7	A	G	7: 45,170,304	I177V	probably benign	Het
Slc28a2	T	A	2: 122,451,013	F228I	probably damaging	Het
Slc35b4	C	T	6: 34,170,549	V35I	probably benign	Het
Slc38a1	T	C	15: 96,578,760	I407V	probably damaging	Het
Slc39a13	A	G	2: 91,063,097	V326A	probably damaging	Het
Slc44a5	T	C	3: 154,239,106	L120P	probably damaging	Het
Slfn3	T	C	11: 83,213,314	I214T	probably damaging	Het
Slitrk3	A	C	3: 73,049,691	S583A	probably benign	Het
Snx14	T	C	9: 88,415,675	Y180C	probably damaging	Het
Sorl1	T	A	9: 41,996,242	K1483I	probably benign	Het
Ssrp1	C	A	2: 85,040,760	H247N	probably damaging	Het
Stk39	A	T	2: 68,307,116		probably benign	Het
Syde1	C	T	10: 78,585,696	G674R	probably damaging	Het
Themis3	G	A	17: 66,555,853	S370L	probably benign	Het
Tll1	T	A	8: 64,101,873	N259Y	probably damaging	Het
Tnip2	T	G	5: 34,503,831		probably benign	Het
Top2b	T	C	14: 16,409,823	V830A	probably benign	Het
Trpm8	T	A	1: 88,365,080	N934K	probably damaging	Het
Ttc14	A	G	3: 33,802,920	Y179C	probably damaging	Het
Ttn	T	G	2: 76,743,621	I17316L	possibly damaging	Het
Tufm	T	C	7: 126,487,699	V52A	probably benign	Het
Vamp8	T	A	6: 72,388,287	N20I	probably benign	Het
Vmn1r170	A	T	7: 23,606,863	H230L	probably benign	Het
Vmn2r50	T	G	7: 10,037,804	T657P	probably damaging	Het
Xirp2	G	A	2: 67,512,418	G1668R	probably benign	Het
Zik1	C	A	7: 10,490,384	R262L	possibly damaging	Het
Zscan25	T	G	5: 145,283,691	Y99D	probably damaging	Het

Other mutations in Psme4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00228:Psme4	APN	11	30815710	critical splice donor site	probably null
IGL00401:Psme4	APN	11	30821079	splice site	probably benign
IGL00475:Psme4	APN	11	30845252	missense	probably benign	0.14
IGL00576:Psme4	APN	11	30823145	missense	possibly damaging	0.50
IGL00817:Psme4	APN	11	30820129	missense	probably benign	0.01
IGL01525:Psme4	APN	11	30809936	splice site	probably benign
IGL01862:Psme4	APN	11	30812038	nonsense	probably null
IGL02310:Psme4	APN	11	30837484	missense	probably benign	0.06
IGL02477:Psme4	APN	11	30842083	missense	probably damaging	0.99
IGL02545:Psme4	APN	11	30841586	missense	possibly damaging	0.81
IGL02608:Psme4	APN	11	30820944	missense	probably benign	0.34
IGL02621:Psme4	APN	11	30848131	missense	probably benign
IGL02822:Psme4	APN	11	30848204	unclassified	probably benign
IGL02833:Psme4	APN	11	30850715	unclassified	probably benign
IGL02964:Psme4	APN	11	30791095	nonsense	probably null
IGL03273:Psme4	APN	11	30848130	missense	probably damaging	1.00
IGL03348:Psme4	APN	11	30876796	missense	probably damaging	1.00
IGL03382:Psme4	APN	11	30807788	missense	possibly damaging	0.94
H2330:Psme4	UTSW	11	30851210	missense	probably benign	0.17
PIT4378001:Psme4	UTSW	11	30821079	splice site	probably benign
R0276:Psme4	UTSW	11	30811980	missense	probably damaging	1.00
R0462:Psme4	UTSW	11	30848117	missense	probably damaging	1.00
R0685:Psme4	UTSW	11	30878415	missense	probably damaging	1.00
R0766:Psme4	UTSW	11	30807687	splice site	probably null
R0830:Psme4	UTSW	11	30807797	missense	possibly damaging	0.53
R0940:Psme4	UTSW	11	30815264	missense	possibly damaging	0.53
R1018:Psme4	UTSW	11	30804310	missense	probably damaging	1.00
R1312:Psme4	UTSW	11	30807687	splice site	probably null
R1448:Psme4	UTSW	11	30852744	missense	probably damaging	1.00
R1732:Psme4	UTSW	11	30848105	missense	probably benign	0.03
R1813:Psme4	UTSW	11	30804353	missense	probably benign	0.14
R1905:Psme4	UTSW	11	30810922	missense	probably damaging	1.00
R1907:Psme4	UTSW	11	30810922	missense	probably damaging	1.00
R1911:Psme4	UTSW	11	30815658	missense	probably benign	0.02
R1956:Psme4	UTSW	11	30832424	missense	probably damaging	0.99
R1974:Psme4	UTSW	11	30819011	missense	probably benign	0.00
R1980:Psme4	UTSW	11	30832615	missense	possibly damaging	0.84
R1986:Psme4	UTSW	11	30830352	missense	probably benign	0.01
R2046:Psme4	UTSW	11	30817723	splice site	probably benign
R2142:Psme4	UTSW	11	30820998	missense	possibly damaging	0.89
R2698:Psme4	UTSW	11	30874282	critical splice donor site	probably null
R2844:Psme4	UTSW	11	30845173	splice site	probably benign
R3807:Psme4	UTSW	11	30856027	splice site	probably null
R3876:Psme4	UTSW	11	30856068	missense	probably damaging	0.99
R4420:Psme4	UTSW	11	30812028	missense	possibly damaging	0.67
R4584:Psme4	UTSW	11	30834318	missense	probably damaging	1.00
R4615:Psme4	UTSW	11	30834287	missense	probably benign	0.02
R4714:Psme4	UTSW	11	30832573	missense	probably benign	0.02
R5008:Psme4	UTSW	11	30856896	intron	probably benign
R5109:Psme4	UTSW	11	30791095	nonsense	probably null
R5155:Psme4	UTSW	11	30876806	missense	probably damaging	1.00
R5199:Psme4	UTSW	11	30853272	missense	probably benign	0.00
R5205:Psme4	UTSW	11	30832666	intron	probably benign
R5452:Psme4	UTSW	11	30791168	missense	probably benign
R5491:Psme4	UTSW	11	30815246	missense	possibly damaging	0.63
R5685:Psme4	UTSW	11	30809837	missense	probably damaging	0.99
R5764:Psme4	UTSW	11	30772364	intron	probably benign
R5853:Psme4	UTSW	11	30791234	critical splice donor site	probably null
R5865:Psme4	UTSW	11	30791993	missense	possibly damaging	0.95
R5903:Psme4	UTSW	11	30841589	missense	probably benign	0.28
R5927:Psme4	UTSW	11	30804294	missense	possibly damaging	0.82
R6004:Psme4	UTSW	11	30856896	intron	probably benign
R6102:Psme4	UTSW	11	30865567	missense	probably damaging	1.00
R6247:Psme4	UTSW	11	30853245	missense	possibly damaging	0.60
R6527:Psme4	UTSW	11	30832175	missense	probably benign
R6750:Psme4	UTSW	11	30853203	missense	probably damaging	1.00
R6885:Psme4	UTSW	11	30834307	nonsense	probably null
R6939:Psme4	UTSW	11	30837291	missense	probably damaging	0.99
R6945:Psme4	UTSW	11	30837437	missense	probably benign	0.06
R7029:Psme4	UTSW	11	30772474	intron	probably benign
R7049:Psme4	UTSW	11	30813904	splice site	probably null
R7098:Psme4	UTSW	11	30850661	missense	probably damaging	0.99
R7107:Psme4	UTSW	11	30848105	missense	probably benign	0.03
R7223:Psme4	UTSW	11	30874226	missense	probably benign	0.33
R7319:Psme4	UTSW	11	30807790	missense	probably benign	0.00
R7375:Psme4	UTSW	11	30772700	splice site	probably null
R7410:Psme4	UTSW	11	30815279	nonsense	probably null
R7469:Psme4	UTSW	11	30802837	missense	probably benign	0.20
R7651:Psme4	UTSW	11	30837334	missense	probably damaging	0.98
R7679:Psme4	UTSW	11	30878425	missense	probably damaging	0.99
R7681:Psme4	UTSW	11	30791975	missense	possibly damaging	0.63
R7822:Psme4	UTSW	11	30874245	missense	probably benign
R8013:Psme4	UTSW	11	30804320	missense	probably benign	0.06
R8130:Psme4	UTSW	11	30842026	missense	probably damaging	1.00
R8323:Psme4	UTSW	11	30843532	missense	probably damaging	0.99
R8330:Psme4	UTSW	11	30843583	missense	probably benign	0.00
R8363:Psme4	UTSW	11	30812139	missense	probably damaging	1.00
R8491:Psme4	UTSW	11	30772161	missense	possibly damaging	0.90
R8690:Psme4	UTSW	11	30837319	missense	probably benign	0.00
R8696:Psme4	UTSW	11	30809896	missense	probably damaging	0.99
R8743:Psme4	UTSW	11	30878467	missense	probably damaging	1.00
R8998:Psme4	UTSW	11	30838957	missense	possibly damaging	0.78
R9241:Psme4	UTSW	11	30865576	missense	probably damaging	1.00
R9657:Psme4	UTSW	11	30838980	missense	probably benign	0.00
R9736:Psme4	UTSW	11	30847411	missense	probably damaging	0.99
R9744:Psme4	UTSW	11	30815294	critical splice donor site	probably null
R9746:Psme4	UTSW	11	30876868	nonsense	probably null
V5088:Psme4	UTSW	11	30851210	missense	probably benign	0.17
X0063:Psme4	UTSW	11	30832600	missense	possibly damaging	0.66
Z1176:Psme4	UTSW	11	30843522	missense	possibly damaging	0.87
Z1177:Psme4	UTSW	11	30806311	missense	probably damaging	1.00
Z1177:Psme4	UTSW	11	30812138	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCATTGTTCTAAGGATTGCTGAAAGGGA -3'
(R):5'- GGGGAGTGGGTAACACTCTAGAATGC -3'

Sequencing Primer
(F):5'- gcacgcactcgcaatcc -3'
(R):5'- CAGACAACTCTTTGAAAGGAATGAAC -3'

Posted On

2014-05-14