Incidental Mutation 'R1713:Top2b'
ID190804
Institutional Source Beutler Lab
Gene Symbol Top2b
Ensembl Gene ENSMUSG00000017485
Gene Nametopoisomerase (DNA) II beta
SynonymsD230016L12Rik, Top-2
MMRRC Submission 039746-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.905) question?
Stock #R1713 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location16365179-16435462 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 16409823 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 830 (V830A)
Ref Sequence ENSEMBL: ENSMUSP00000017629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017629] [ENSMUST00000161693]
Predicted Effect probably benign
Transcript: ENSMUST00000017629
AA Change: V830A

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000017629
Gene: ENSMUSG00000017485
AA Change: V830A

DomainStartEndE-ValueType
Blast:TOP2c 32 70 7e-10 BLAST
HATPase_c 85 234 1.91e-2 SMART
TOP2c 89 679 N/A SMART
TOP4c 702 1175 2.55e-230 SMART
low complexity region 1201 1215 N/A INTRINSIC
low complexity region 1287 1299 N/A INTRINSIC
low complexity region 1324 1336 N/A INTRINSIC
low complexity region 1360 1382 N/A INTRINSIC
Pfam:DTHCT 1495 1597 4.6e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159302
SMART Domains Protein: ENSMUSP00000123789
Gene: ENSMUSG00000017485

DomainStartEndE-ValueType
TOP4c 1 177 4.06e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160501
SMART Domains Protein: ENSMUSP00000124889
Gene: ENSMUSG00000017485

DomainStartEndE-ValueType
TOP4c 2 222 3.97e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161693
SMART Domains Protein: ENSMUSP00000123992
Gene: ENSMUSG00000017485

DomainStartEndE-ValueType
Pfam:DNA_topoisoIV 1 117 1.2e-12 PFAM
low complexity region 161 173 N/A INTRINSIC
low complexity region 198 210 N/A INTRINSIC
low complexity region 234 256 N/A INTRINSIC
Meta Mutation Damage Score 0.0855 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 98% (96/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This nuclear enzyme is involved in processes such as chromosome condensation, chromatid separation, and the relief of torsional stress that occurs during DNA transcription and replication. It catalyzes the transient breaking and rejoining of two strands of duplex DNA which allows the strands to pass through one another, thus altering the topology of DNA. Two forms of this enzyme exist as likely products of a gene duplication event. The gene encoding this form, beta, is localized to chromosome 3 and the alpha form is localized to chromosome 17. The gene encoding this enzyme functions as the target for several anticancer agents and a variety of mutations in this gene have been associated with the development of drug resistance. Reduced activity of this enzyme may also play a role in ataxia-telangiectasia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous null mice exhibit abnormal innervation. Offspring die shortly after birth due to respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik T A 4: 103,270,767 I54F possibly damaging Het
Ackr1 A T 1: 173,332,349 H134Q probably benign Het
Agtr1b A T 3: 20,316,309 F44L probably benign Het
Ahnak G A 19: 9,011,809 D3486N possibly damaging Het
Akap9 T C 5: 4,039,345 probably null Het
Anks6 T A 4: 47,039,726 Q495L probably benign Het
Arpp21 A G 9: 112,067,169 S684P probably damaging Het
Ash1l A G 3: 89,076,224 E2911G probably damaging Het
Avpi1 C T 19: 42,124,809 E70K probably damaging Het
Btbd17 G T 11: 114,795,824 P9T probably benign Het
C4b A G 17: 34,729,271 probably benign Het
Carm1 T C 9: 21,586,489 V385A probably damaging Het
Casd1 A G 6: 4,624,104 D299G probably damaging Het
Clca1 T A 3: 145,024,546 K179N probably benign Het
Col1a2 T C 6: 4,538,691 S1204P unknown Het
Col24a1 C T 3: 145,366,869 Q780* probably null Het
Cxadr C A 16: 78,334,245 N216K probably damaging Het
Daam1 C T 12: 71,895,882 T40I unknown Het
Dab2 C T 15: 6,429,701 P365S possibly damaging Het
Dnah1 A T 14: 31,279,182 I2402N probably damaging Het
Dscaml1 T A 9: 45,752,690 S1954R possibly damaging Het
Dync2h1 T C 9: 7,131,891 T1639A probably benign Het
Ebf1 A T 11: 44,924,566 I336F probably damaging Het
Ebna1bp2 A G 4: 118,625,684 N290S possibly damaging Het
Gabra2 A G 5: 71,014,563 I110T probably benign Het
Galk2 A G 2: 125,931,290 N203S probably benign Het
Gria4 T C 9: 4,424,448 T806A probably benign Het
Impg2 A G 16: 56,260,526 T789A probably benign Het
Itga6 A G 2: 71,787,202 T22A probably benign Het
Itgb4 T A 11: 116,003,489 I1312N probably damaging Het
Kdm4c A G 4: 74,298,484 D160G probably benign Het
Kdr A G 5: 75,968,467 V173A probably benign Het
Kif14 T C 1: 136,527,464 S1575P probably benign Het
Lcp1 G A 14: 75,199,444 probably null Het
Lipe C A 7: 25,385,325 S516I probably damaging Het
Lrrc61 G A 6: 48,568,774 R177Q possibly damaging Het
Macf1 A G 4: 123,378,694 I6429T probably damaging Het
Map3k4 C T 17: 12,249,571 E1012K probably benign Het
Map3k5 T C 10: 20,110,847 F936L possibly damaging Het
Mllt3 A T 4: 87,783,664 N497K probably damaging Het
Moxd1 G A 10: 24,281,496 G342D probably damaging Het
Mtdh A C 15: 34,114,839 Q202H possibly damaging Het
Nav1 A G 1: 135,595,234 probably benign Het
Nop56 T C 2: 130,277,966 V109A possibly damaging Het
Obscn T C 11: 59,079,886 D2540G probably damaging Het
Olfr1121 A T 2: 87,371,946 Y138F probably damaging Het
Olfr1495 A T 19: 13,769,295 T318S probably benign Het
Omg T C 11: 79,502,853 I60V probably benign Het
Osbpl5 G A 7: 143,694,373 H652Y probably damaging Het
Papd7 A T 13: 69,503,051 I565N probably benign Het
Parvb T C 15: 84,297,991 probably benign Het
Pcdhb3 A C 18: 37,303,322 E780D probably benign Het
Pik3c3 A G 18: 30,323,586 D723G possibly damaging Het
Prkdc T C 16: 15,795,094 V3172A probably benign Het
Psme4 G T 11: 30,806,310 W272L probably damaging Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Rhobtb1 A C 10: 69,272,771 S434R probably benign Het
Rhobtb1 G C 10: 69,272,772 S434T possibly damaging Het
Rnf8 T C 17: 29,634,761 F413S probably damaging Het
Rpn2 A G 2: 157,314,968 N497S probably damaging Het
Rsbn1l G T 5: 20,951,490 P99Q probably benign Het
Serpinb3b A T 1: 107,155,434 M246K probably benign Het
Sgsm2 T C 11: 74,896,826 E19G probably null Het
Shank1 A G 7: 44,319,737 H352R unknown Het
Slc17a7 A G 7: 45,170,304 I177V probably benign Het
Slc28a2 T A 2: 122,451,013 F228I probably damaging Het
Slc35b4 C T 6: 34,170,549 V35I probably benign Het
Slc38a1 T C 15: 96,578,760 I407V probably damaging Het
Slc39a13 A G 2: 91,063,097 V326A probably damaging Het
Slc44a5 T C 3: 154,239,106 L120P probably damaging Het
Slfn3 T C 11: 83,213,314 I214T probably damaging Het
Slitrk3 A C 3: 73,049,691 S583A probably benign Het
Snx14 T C 9: 88,415,675 Y180C probably damaging Het
Sorl1 T A 9: 41,996,242 K1483I probably benign Het
Ssrp1 C A 2: 85,040,760 H247N probably damaging Het
Stk39 A T 2: 68,307,116 probably benign Het
Syde1 C T 10: 78,585,696 G674R probably damaging Het
Themis3 G A 17: 66,555,853 S370L probably benign Het
Tll1 T A 8: 64,101,873 N259Y probably damaging Het
Tnip2 T G 5: 34,503,831 probably benign Het
Trpm8 T A 1: 88,365,080 N934K probably damaging Het
Ttc14 A G 3: 33,802,920 Y179C probably damaging Het
Ttn T G 2: 76,743,621 I17316L possibly damaging Het
Tufm T C 7: 126,487,699 V52A probably benign Het
Vamp8 T A 6: 72,388,287 N20I probably benign Het
Vmn1r170 A T 7: 23,606,863 H230L probably benign Het
Vmn2r50 T G 7: 10,037,804 T657P probably damaging Het
Xirp2 G A 2: 67,512,418 G1668R probably benign Het
Zik1 C A 7: 10,490,384 R262L possibly damaging Het
Zscan25 T G 5: 145,283,691 Y99D probably damaging Het
Other mutations in Top2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Top2b APN 14 16422692 missense probably benign 0.00
IGL00730:Top2b APN 14 16389831 missense probably damaging 1.00
IGL00917:Top2b APN 14 16407354 missense probably benign 0.05
IGL01959:Top2b APN 14 16422695 missense probably benign 0.19
IGL02019:Top2b APN 14 16409965 missense probably benign 0.44
IGL02119:Top2b APN 14 16406733 missense probably damaging 1.00
IGL02136:Top2b APN 14 16407103 unclassified probably benign
IGL02148:Top2b APN 14 16400488 missense probably damaging 1.00
IGL02496:Top2b APN 14 16387335 missense probably benign
IGL02503:Top2b APN 14 16407163 missense possibly damaging 0.92
IGL02672:Top2b APN 14 16409166 unclassified probably benign
IGL02721:Top2b APN 14 16409236 missense probably damaging 1.00
IGL02886:Top2b APN 14 16365688 missense possibly damaging 0.73
IGL03252:Top2b APN 14 16393163 missense possibly damaging 0.60
PIT4434001:Top2b UTSW 14 16423780 critical splice donor site probably null
R0092:Top2b UTSW 14 16409263 missense probably damaging 1.00
R0201:Top2b UTSW 14 16383174 missense probably damaging 1.00
R0390:Top2b UTSW 14 16418442 missense probably benign 0.00
R0394:Top2b UTSW 14 16413556 splice site probably null
R1159:Top2b UTSW 14 16430329 missense possibly damaging 0.81
R1424:Top2b UTSW 14 16383177 missense probably damaging 1.00
R1519:Top2b UTSW 14 16408953 splice site probably null
R1561:Top2b UTSW 14 16398993 missense possibly damaging 0.80
R1987:Top2b UTSW 14 16398916 missense probably damaging 0.99
R2219:Top2b UTSW 14 16409189 missense probably damaging 1.00
R2287:Top2b UTSW 14 16409189 missense probably damaging 1.00
R2422:Top2b UTSW 14 16409189 missense probably damaging 1.00
R2679:Top2b UTSW 14 16413947 missense probably damaging 1.00
R3687:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3707:Top2b UTSW 14 16388447 missense probably damaging 1.00
R3810:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3812:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3815:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3816:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3818:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4023:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4025:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4026:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4133:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4157:Top2b UTSW 14 16384491 missense probably benign 0.42
R4179:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4180:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4300:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4376:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4377:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4492:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4549:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4550:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4581:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4582:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4628:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4630:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4667:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4668:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4669:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4698:Top2b UTSW 14 16387331 nonsense probably null
R4769:Top2b UTSW 14 16398991 missense probably damaging 1.00
R4809:Top2b UTSW 14 16383125 missense probably benign 0.06
R4899:Top2b UTSW 14 16387313 missense probably damaging 1.00
R5035:Top2b UTSW 14 16409966 missense probably benign 0.01
R5621:Top2b UTSW 14 16387280 missense probably damaging 1.00
R5631:Top2b UTSW 14 16409882 missense probably damaging 1.00
R5685:Top2b UTSW 14 16413666 missense probably damaging 1.00
R5732:Top2b UTSW 14 16400106 missense possibly damaging 0.92
R5939:Top2b UTSW 14 16422786 missense probably damaging 0.96
R6007:Top2b UTSW 14 16423779 critical splice donor site probably null
R6087:Top2b UTSW 14 16409864 missense probably benign 0.14
R6144:Top2b UTSW 14 16423740 missense possibly damaging 0.48
R6196:Top2b UTSW 14 16409189 missense probably damaging 1.00
R6218:Top2b UTSW 14 16409189 missense probably damaging 1.00
R6229:Top2b UTSW 14 16409838 missense probably damaging 1.00
R6249:Top2b UTSW 14 16399006 missense probably damaging 1.00
R6337:Top2b UTSW 14 16399026 missense possibly damaging 0.77
R6353:Top2b UTSW 14 16416671 missense probably damaging 1.00
R6512:Top2b UTSW 14 16409854 missense possibly damaging 0.94
R6573:Top2b UTSW 14 16398991 missense probably damaging 1.00
R6614:Top2b UTSW 14 16407142 nonsense probably null
R6844:Top2b UTSW 14 16429383 missense possibly damaging 0.94
R6848:Top2b UTSW 14 16409958 missense possibly damaging 0.89
R6871:Top2b UTSW 14 16409189 missense probably damaging 1.00
R6895:Top2b UTSW 14 16413604 missense probably benign 0.06
R7162:Top2b UTSW 14 16416653 missense probably benign 0.00
R7247:Top2b UTSW 14 16416962 missense probably benign 0.08
R7250:Top2b UTSW 14 16420411 missense probably benign
R7359:Top2b UTSW 14 16407376 missense probably null 1.00
R7365:Top2b UTSW 14 16416649 missense probably benign 0.04
R7493:Top2b UTSW 14 16416605 missense probably benign 0.00
R7528:Top2b UTSW 14 16395427 nonsense probably null
R7562:Top2b UTSW 14 16412946 missense probably benign 0.04
R7594:Top2b UTSW 14 16428587 missense probably benign
R7670:Top2b UTSW 14 16416620 missense possibly damaging 0.61
X0028:Top2b UTSW 14 16384499 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAAGATGCTGCAAGCCCTCGTTAT -3'
(R):5'- GCATCCGCCTGACATTGTTCACA -3'

Sequencing Primer
(F):5'- CATAAAGACTCATACTGGCTTGTGC -3'
(R):5'- CAATTTCTCTAGCATCATAGTTGGGC -3'
Posted On2014-05-14