Incidental Mutation 'R1713:Lcp1'
ID 190807
Institutional Source Beutler Lab
Gene Symbol Lcp1
Ensembl Gene ENSMUSG00000021998
Gene Name lymphocyte cytosolic protein 1
Synonyms L-fimbrin, L-plastin, D14Ertd310e, Pls2
MMRRC Submission 039746-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1713 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 75368545-75468282 bp(+) (GRCm39)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 75436884 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122840] [ENSMUST00000124499] [ENSMUST00000125833] [ENSMUST00000131802] [ENSMUST00000134114] [ENSMUST00000145303] [ENSMUST00000143539]
AlphaFold Q61233
Predicted Effect probably null
Transcript: ENSMUST00000122840
SMART Domains Protein: ENSMUSP00000117984
Gene: ENSMUSG00000021998

DomainStartEndE-ValueType
EFh 13 41 6.91e-5 SMART
EFh 53 81 7.7e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000124499
SMART Domains Protein: ENSMUSP00000121201
Gene: ENSMUSG00000021998

DomainStartEndE-ValueType
EFh 13 41 6.91e-5 SMART
EFh 53 81 7.7e-3 SMART
CH 122 234 1.15e-24 SMART
CH 266 373 1.51e-19 SMART
CH 396 501 1.87e-24 SMART
CH 517 622 8.55e-19 SMART
Predicted Effect probably null
Transcript: ENSMUST00000125833
SMART Domains Protein: ENSMUSP00000116033
Gene: ENSMUSG00000021998

DomainStartEndE-ValueType
EFh 13 41 6.91e-5 SMART
EFh 53 81 7.7e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130510
Predicted Effect probably null
Transcript: ENSMUST00000131802
SMART Domains Protein: ENSMUSP00000117137
Gene: ENSMUSG00000021998

DomainStartEndE-ValueType
EFh 13 41 6.91e-5 SMART
EFh 53 81 7.7e-3 SMART
CH 122 234 1.15e-24 SMART
CH 266 373 1.51e-19 SMART
CH 396 501 1.87e-24 SMART
CH 517 622 8.55e-19 SMART
Predicted Effect probably null
Transcript: ENSMUST00000134114
SMART Domains Protein: ENSMUSP00000121376
Gene: ENSMUSG00000021998

DomainStartEndE-ValueType
EFh 13 41 6.91e-5 SMART
EFh 53 81 7.7e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000145303
SMART Domains Protein: ENSMUSP00000116271
Gene: ENSMUSG00000021998

DomainStartEndE-ValueType
EFh 13 41 6.91e-5 SMART
EFh 53 81 7.7e-3 SMART
CH 122 234 1.15e-24 SMART
CH 266 373 1.51e-19 SMART
CH 396 501 1.87e-24 SMART
CH 517 622 8.55e-19 SMART
Predicted Effect probably null
Transcript: ENSMUST00000143539
SMART Domains Protein: ENSMUSP00000118721
Gene: ENSMUSG00000021998

DomainStartEndE-ValueType
EFh 13 41 6.91e-5 SMART
EFh 53 76 4.45e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149883
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161819
Meta Mutation Damage Score 0.9588 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 98% (96/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Plastins are a family of actin-binding proteins that are conserved throughout eukaryote evolution and expressed in most tissues of higher eukaryotes. In humans, two ubiquitous plastin isoforms (L and T) have been identified. Plastin 1 (otherwise known as Fimbrin) is a third distinct plastin isoform which is specifically expressed at high levels in the small intestine. The L isoform is expressed only in hemopoietic cell lineages, while the T isoform has been found in all other normal cells of solid tissues that have replicative potential (fibroblasts, endothelial cells, epithelial cells, melanocytes, etc.). However, L-plastin has been found in many types of malignant human cells of non-hemopoietic origin suggesting that its expression is induced accompanying tumorigenesis in solid tissues. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to S. aureus infection, defective neutrophil killing of S. aureus, and impaired adhesion-dependent respiratory bursts in neutrophils. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik T A 4: 103,127,964 (GRCm39) I54F possibly damaging Het
Ackr1 A T 1: 173,159,916 (GRCm39) H134Q probably benign Het
Agtr1b A T 3: 20,370,473 (GRCm39) F44L probably benign Het
Ahnak G A 19: 8,989,173 (GRCm39) D3486N possibly damaging Het
Akap9 T C 5: 4,089,345 (GRCm39) probably null Het
Anks6 T A 4: 47,039,726 (GRCm39) Q495L probably benign Het
Arpp21 A G 9: 111,896,237 (GRCm39) S684P probably damaging Het
Ash1l A G 3: 88,983,531 (GRCm39) E2911G probably damaging Het
Avpi1 C T 19: 42,113,248 (GRCm39) E70K probably damaging Het
Btbd17 G T 11: 114,686,650 (GRCm39) P9T probably benign Het
C4b A G 17: 34,948,245 (GRCm39) probably benign Het
Carm1 T C 9: 21,497,785 (GRCm39) V385A probably damaging Het
Casd1 A G 6: 4,624,104 (GRCm39) D299G probably damaging Het
Clca3a1 T A 3: 144,730,307 (GRCm39) K179N probably benign Het
Col1a2 T C 6: 4,538,691 (GRCm39) S1204P unknown Het
Col24a1 C T 3: 145,072,624 (GRCm39) Q780* probably null Het
Cxadr C A 16: 78,131,133 (GRCm39) N216K probably damaging Het
Daam1 C T 12: 71,942,656 (GRCm39) T40I unknown Het
Dab2 C T 15: 6,459,182 (GRCm39) P365S possibly damaging Het
Dnah1 A T 14: 31,001,139 (GRCm39) I2402N probably damaging Het
Dscaml1 T A 9: 45,663,988 (GRCm39) S1954R possibly damaging Het
Dync2h1 T C 9: 7,131,891 (GRCm39) T1639A probably benign Het
Ebf1 A T 11: 44,815,393 (GRCm39) I336F probably damaging Het
Ebna1bp2 A G 4: 118,482,881 (GRCm39) N290S possibly damaging Het
Gabra2 A G 5: 71,171,906 (GRCm39) I110T probably benign Het
Galk2 A G 2: 125,773,210 (GRCm39) N203S probably benign Het
Gria4 T C 9: 4,424,448 (GRCm39) T806A probably benign Het
Impg2 A G 16: 56,080,889 (GRCm39) T789A probably benign Het
Itga6 A G 2: 71,617,546 (GRCm39) T22A probably benign Het
Itgb4 T A 11: 115,894,315 (GRCm39) I1312N probably damaging Het
Kdm4c A G 4: 74,216,721 (GRCm39) D160G probably benign Het
Kdr A G 5: 76,129,127 (GRCm39) V173A probably benign Het
Kif14 T C 1: 136,455,202 (GRCm39) S1575P probably benign Het
Lipe C A 7: 25,084,750 (GRCm39) S516I probably damaging Het
Lrrc61 G A 6: 48,545,708 (GRCm39) R177Q possibly damaging Het
Macf1 A G 4: 123,272,487 (GRCm39) I6429T probably damaging Het
Map3k4 C T 17: 12,468,458 (GRCm39) E1012K probably benign Het
Map3k5 T C 10: 19,986,593 (GRCm39) F936L possibly damaging Het
Mllt3 A T 4: 87,701,901 (GRCm39) N497K probably damaging Het
Moxd1 G A 10: 24,157,394 (GRCm39) G342D probably damaging Het
Mtdh A C 15: 34,114,985 (GRCm39) Q202H possibly damaging Het
Nav1 A G 1: 135,522,972 (GRCm39) probably benign Het
Nop56 T C 2: 130,119,886 (GRCm39) V109A possibly damaging Het
Obscn T C 11: 58,970,712 (GRCm39) D2540G probably damaging Het
Omg T C 11: 79,393,679 (GRCm39) I60V probably benign Het
Or10q12 A T 19: 13,746,659 (GRCm39) T318S probably benign Het
Or12e9 A T 2: 87,202,290 (GRCm39) Y138F probably damaging Het
Osbpl5 G A 7: 143,248,110 (GRCm39) H652Y probably damaging Het
Parvb T C 15: 84,182,192 (GRCm39) probably benign Het
Pcdhb3 A C 18: 37,436,375 (GRCm39) E780D probably benign Het
Pik3c3 A G 18: 30,456,639 (GRCm39) D723G possibly damaging Het
Prkdc T C 16: 15,612,958 (GRCm39) V3172A probably benign Het
Psme4 G T 11: 30,756,310 (GRCm39) W272L probably damaging Het
Rem1 G A 2: 152,476,455 (GRCm39) V238M probably damaging Het
Rhobtb1 A C 10: 69,108,601 (GRCm39) S434R probably benign Het
Rhobtb1 G C 10: 69,108,602 (GRCm39) S434T possibly damaging Het
Rnf8 T C 17: 29,853,735 (GRCm39) F413S probably damaging Het
Rpn2 A G 2: 157,156,888 (GRCm39) N497S probably damaging Het
Rsbn1l G T 5: 21,156,488 (GRCm39) P99Q probably benign Het
Serpinb3b A T 1: 107,083,164 (GRCm39) M246K probably benign Het
Sgsm2 T C 11: 74,787,652 (GRCm39) E19G probably null Het
Shank1 A G 7: 43,969,161 (GRCm39) H352R unknown Het
Slc17a7 A G 7: 44,819,728 (GRCm39) I177V probably benign Het
Slc28a2 T A 2: 122,281,494 (GRCm39) F228I probably damaging Het
Slc35b4 C T 6: 34,147,484 (GRCm39) V35I probably benign Het
Slc38a1 T C 15: 96,476,641 (GRCm39) I407V probably damaging Het
Slc39a13 A G 2: 90,893,442 (GRCm39) V326A probably damaging Het
Slc44a5 T C 3: 153,944,743 (GRCm39) L120P probably damaging Het
Slfn3 T C 11: 83,104,140 (GRCm39) I214T probably damaging Het
Slitrk3 A C 3: 72,957,024 (GRCm39) S583A probably benign Het
Snx14 T C 9: 88,297,728 (GRCm39) Y180C probably damaging Het
Sorl1 T A 9: 41,907,538 (GRCm39) K1483I probably benign Het
Ssrp1 C A 2: 84,871,104 (GRCm39) H247N probably damaging Het
Stk39 A T 2: 68,137,460 (GRCm39) probably benign Het
Syde1 C T 10: 78,421,530 (GRCm39) G674R probably damaging Het
Tent4a A T 13: 69,651,170 (GRCm39) I565N probably benign Het
Themis3 G A 17: 66,862,848 (GRCm39) S370L probably benign Het
Tll1 T A 8: 64,554,907 (GRCm39) N259Y probably damaging Het
Tnip2 T G 5: 34,661,175 (GRCm39) probably benign Het
Top2b T C 14: 16,409,823 (GRCm38) V830A probably benign Het
Trpm8 T A 1: 88,292,802 (GRCm39) N934K probably damaging Het
Ttc14 A G 3: 33,857,069 (GRCm39) Y179C probably damaging Het
Ttn T G 2: 76,573,965 (GRCm39) I17316L possibly damaging Het
Tufm T C 7: 126,086,871 (GRCm39) V52A probably benign Het
Vamp8 T A 6: 72,365,270 (GRCm39) N20I probably benign Het
Vmn1r170 A T 7: 23,306,288 (GRCm39) H230L probably benign Het
Vmn2r50 T G 7: 9,771,731 (GRCm39) T657P probably damaging Het
Xirp2 G A 2: 67,342,762 (GRCm39) G1668R probably benign Het
Zik1 C A 7: 10,224,311 (GRCm39) R262L possibly damaging Het
Zscan25 T G 5: 145,220,501 (GRCm39) Y99D probably damaging Het
Other mutations in Lcp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01103:Lcp1 APN 14 75,464,533 (GRCm39) critical splice donor site probably null
IGL01768:Lcp1 APN 14 75,461,573 (GRCm39) missense probably benign 0.40
IGL01801:Lcp1 APN 14 75,436,815 (GRCm39) missense probably benign 0.10
IGL01940:Lcp1 APN 14 75,453,805 (GRCm39) missense probably benign 0.17
IGL02135:Lcp1 APN 14 75,437,926 (GRCm39) missense probably benign 0.00
IGL02185:Lcp1 APN 14 75,466,740 (GRCm39) missense possibly damaging 0.73
IGL02478:Lcp1 APN 14 75,461,536 (GRCm39) missense probably benign 0.04
IGL02604:Lcp1 APN 14 75,461,566 (GRCm39) missense probably benign 0.11
R0244:Lcp1 UTSW 14 75,464,441 (GRCm39) missense possibly damaging 0.92
R0295:Lcp1 UTSW 14 75,436,860 (GRCm39) missense probably null 0.59
R0313:Lcp1 UTSW 14 75,436,873 (GRCm39) missense probably damaging 1.00
R0415:Lcp1 UTSW 14 75,464,446 (GRCm39) missense possibly damaging 0.88
R0751:Lcp1 UTSW 14 75,436,827 (GRCm39) missense probably benign 0.00
R0811:Lcp1 UTSW 14 75,451,928 (GRCm39) missense probably benign 0.00
R0812:Lcp1 UTSW 14 75,451,928 (GRCm39) missense probably benign 0.00
R1200:Lcp1 UTSW 14 75,466,742 (GRCm39) missense possibly damaging 0.73
R1915:Lcp1 UTSW 14 75,436,737 (GRCm39) missense possibly damaging 0.81
R1969:Lcp1 UTSW 14 75,437,946 (GRCm39) missense probably damaging 1.00
R1970:Lcp1 UTSW 14 75,437,946 (GRCm39) missense probably damaging 1.00
R1971:Lcp1 UTSW 14 75,437,946 (GRCm39) missense probably damaging 1.00
R2045:Lcp1 UTSW 14 75,437,841 (GRCm39) missense probably benign 0.01
R2064:Lcp1 UTSW 14 75,435,515 (GRCm39) critical splice acceptor site probably null
R3949:Lcp1 UTSW 14 75,443,569 (GRCm39) missense possibly damaging 0.68
R4062:Lcp1 UTSW 14 75,452,620 (GRCm39) missense probably damaging 1.00
R4521:Lcp1 UTSW 14 75,452,608 (GRCm39) missense possibly damaging 0.94
R4811:Lcp1 UTSW 14 75,437,848 (GRCm39) missense probably damaging 0.99
R4854:Lcp1 UTSW 14 75,437,929 (GRCm39) missense probably damaging 1.00
R4974:Lcp1 UTSW 14 75,445,911 (GRCm39) nonsense probably null
R5539:Lcp1 UTSW 14 75,466,738 (GRCm39) missense probably benign 0.08
R5561:Lcp1 UTSW 14 75,449,948 (GRCm39) missense probably benign 0.01
R5724:Lcp1 UTSW 14 75,464,422 (GRCm39) missense probably benign 0.18
R5989:Lcp1 UTSW 14 75,436,827 (GRCm39) missense probably benign 0.00
R6731:Lcp1 UTSW 14 75,443,629 (GRCm39) missense probably damaging 1.00
R7346:Lcp1 UTSW 14 75,447,946 (GRCm39) missense possibly damaging 0.49
R7670:Lcp1 UTSW 14 75,437,871 (GRCm39) missense probably benign 0.12
R7698:Lcp1 UTSW 14 75,443,651 (GRCm39) nonsense probably null
R9780:Lcp1 UTSW 14 75,440,178 (GRCm39) missense probably damaging 1.00
S24628:Lcp1 UTSW 14 75,464,446 (GRCm39) missense possibly damaging 0.88
X0027:Lcp1 UTSW 14 75,464,526 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCGATGGCAACGGATACATCAG -3'
(R):5'- TGCCTTAGGTTCCCAAGGGCAG -3'

Sequencing Primer
(F):5'- GCTGCAATGAGCTAAATGACTTG -3'
(R):5'- tgaacctctgaaactgtaagcc -3'
Posted On 2014-05-14