Incidental Mutation 'R1713:Dab2'
ID190808
Institutional Source Beutler Lab
Gene Symbol Dab2
Ensembl Gene ENSMUSG00000022150
Gene Namedisabled 2, mitogen-responsive phosphoprotein
Synonyms5730435J12Rik, p96, D630005B22Rik, D15Wsu122e
MMRRC Submission 039746-MU
Accession Numbers

Genbank: NM_023118, NM_001008702, MGI: 109175

Is this an essential gene? Probably essential (E-score: 0.920) question?
Stock #R1713 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location6299788-6440712 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 6429701 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 365 (P365S)
Ref Sequence ENSEMBL: ENSMUSP00000079689 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078019] [ENSMUST00000080880] [ENSMUST00000110663] [ENSMUST00000110664] [ENSMUST00000160134] [ENSMUST00000161040] [ENSMUST00000161812]
Predicted Effect probably benign
Transcript: ENSMUST00000078019
SMART Domains Protein: ENSMUSP00000077166
Gene: ENSMUSG00000022150

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PTB 45 179 1.16e-27 SMART
low complexity region 270 288 N/A INTRINSIC
low complexity region 292 306 N/A INTRINSIC
low complexity region 335 355 N/A INTRINSIC
low complexity region 378 394 N/A INTRINSIC
PDB:3H8D|H 465 493 2e-12 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000080880
AA Change: P365S

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000079689
Gene: ENSMUSG00000022150
AA Change: P365S

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PTB 45 179 1.16e-27 SMART
low complexity region 488 506 N/A INTRINSIC
low complexity region 510 524 N/A INTRINSIC
low complexity region 553 573 N/A INTRINSIC
low complexity region 596 612 N/A INTRINSIC
PDB:3H8D|H 683 711 3e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000110663
SMART Domains Protein: ENSMUSP00000106291
Gene: ENSMUSG00000022150

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PTB 45 179 1.16e-27 SMART
low complexity region 270 288 N/A INTRINSIC
low complexity region 292 306 N/A INTRINSIC
low complexity region 335 355 N/A INTRINSIC
low complexity region 378 394 N/A INTRINSIC
PDB:3H8D|H 465 493 2e-12 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000110664
AA Change: P344S

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106292
Gene: ENSMUSG00000022150
AA Change: P344S

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PTB 45 179 1.16e-27 SMART
low complexity region 467 485 N/A INTRINSIC
low complexity region 489 503 N/A INTRINSIC
low complexity region 532 552 N/A INTRINSIC
low complexity region 575 591 N/A INTRINSIC
PDB:3H8D|H 662 690 3e-12 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159552
Predicted Effect probably benign
Transcript: ENSMUST00000160134
SMART Domains Protein: ENSMUSP00000125021
Gene: ENSMUSG00000022150

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PTB 45 179 1.16e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161040
SMART Domains Protein: ENSMUSP00000124478
Gene: ENSMUSG00000022150

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PTB 45 179 1.16e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161558
Predicted Effect probably benign
Transcript: ENSMUST00000161812
SMART Domains Protein: ENSMUSP00000124589
Gene: ENSMUSG00000022150

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PTB 45 179 1.16e-27 SMART
low complexity region 249 267 N/A INTRINSIC
low complexity region 271 285 N/A INTRINSIC
low complexity region 314 334 N/A INTRINSIC
low complexity region 357 373 N/A INTRINSIC
PDB:3H8D|H 444 472 2e-12 PDB
Predicted Effect unknown
Transcript: ENSMUST00000163082
AA Change: P232S
SMART Domains Protein: ENSMUSP00000124996
Gene: ENSMUSG00000022150
AA Change: P232S

DomainStartEndE-ValueType
Blast:PTB 2 59 1e-33 BLAST
PDB:1P3R|C 2 59 2e-34 PDB
SCOP:d1ddma_ 3 59 9e-12 SMART
low complexity region 60 79 N/A INTRINSIC
low complexity region 356 374 N/A INTRINSIC
low complexity region 378 392 N/A INTRINSIC
low complexity region 421 441 N/A INTRINSIC
low complexity region 464 480 N/A INTRINSIC
PDB:3H8D|H 551 579 3e-12 PDB
Meta Mutation Damage Score 0.0904 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 98% (96/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitogen-responsive phosphoprotein. It is expressed in normal ovarian epithelial cells, but is down-regulated or absent from ovarian carcinoma cell lines, suggesting its role as a tumor suppressor. This protein binds to the SH3 domains of GRB2, an adaptor protein that couples tyrosine kinase receptors to SOS (a guanine nucleotide exchange factor for Ras), via its C-terminal proline-rich sequences, and may thus modulate growth factor/Ras pathways by competing with SOS for binding to GRB2. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mutants exhibit abnormal primitive endoderm structure and/or function, lack a proamniotic cavity and die prior to embryonic day 9.5. A conditional mutant survives, but shows kidney proximal tubule abnormality. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik T A 4: 103,270,767 I54F possibly damaging Het
Ackr1 A T 1: 173,332,349 H134Q probably benign Het
Agtr1b A T 3: 20,316,309 F44L probably benign Het
Ahnak G A 19: 9,011,809 D3486N possibly damaging Het
Akap9 T C 5: 4,039,345 probably null Het
Anks6 T A 4: 47,039,726 Q495L probably benign Het
Arpp21 A G 9: 112,067,169 S684P probably damaging Het
Ash1l A G 3: 89,076,224 E2911G probably damaging Het
Avpi1 C T 19: 42,124,809 E70K probably damaging Het
Btbd17 G T 11: 114,795,824 P9T probably benign Het
C4b A G 17: 34,729,271 probably benign Het
Carm1 T C 9: 21,586,489 V385A probably damaging Het
Casd1 A G 6: 4,624,104 D299G probably damaging Het
Clca1 T A 3: 145,024,546 K179N probably benign Het
Col1a2 T C 6: 4,538,691 S1204P unknown Het
Col24a1 C T 3: 145,366,869 Q780* probably null Het
Cxadr C A 16: 78,334,245 N216K probably damaging Het
Daam1 C T 12: 71,895,882 T40I unknown Het
Dnah1 A T 14: 31,279,182 I2402N probably damaging Het
Dscaml1 T A 9: 45,752,690 S1954R possibly damaging Het
Dync2h1 T C 9: 7,131,891 T1639A probably benign Het
Ebf1 A T 11: 44,924,566 I336F probably damaging Het
Ebna1bp2 A G 4: 118,625,684 N290S possibly damaging Het
Gabra2 A G 5: 71,014,563 I110T probably benign Het
Galk2 A G 2: 125,931,290 N203S probably benign Het
Gria4 T C 9: 4,424,448 T806A probably benign Het
Impg2 A G 16: 56,260,526 T789A probably benign Het
Itga6 A G 2: 71,787,202 T22A probably benign Het
Itgb4 T A 11: 116,003,489 I1312N probably damaging Het
Kdm4c A G 4: 74,298,484 D160G probably benign Het
Kdr A G 5: 75,968,467 V173A probably benign Het
Kif14 T C 1: 136,527,464 S1575P probably benign Het
Lcp1 G A 14: 75,199,444 probably null Het
Lipe C A 7: 25,385,325 S516I probably damaging Het
Lrrc61 G A 6: 48,568,774 R177Q possibly damaging Het
Macf1 A G 4: 123,378,694 I6429T probably damaging Het
Map3k4 C T 17: 12,249,571 E1012K probably benign Het
Map3k5 T C 10: 20,110,847 F936L possibly damaging Het
Mllt3 A T 4: 87,783,664 N497K probably damaging Het
Moxd1 G A 10: 24,281,496 G342D probably damaging Het
Mtdh A C 15: 34,114,839 Q202H possibly damaging Het
Nav1 A G 1: 135,595,234 probably benign Het
Nop56 T C 2: 130,277,966 V109A possibly damaging Het
Obscn T C 11: 59,079,886 D2540G probably damaging Het
Olfr1121 A T 2: 87,371,946 Y138F probably damaging Het
Olfr1495 A T 19: 13,769,295 T318S probably benign Het
Omg T C 11: 79,502,853 I60V probably benign Het
Osbpl5 G A 7: 143,694,373 H652Y probably damaging Het
Papd7 A T 13: 69,503,051 I565N probably benign Het
Parvb T C 15: 84,297,991 probably benign Het
Pcdhb3 A C 18: 37,303,322 E780D probably benign Het
Pik3c3 A G 18: 30,323,586 D723G possibly damaging Het
Prkdc T C 16: 15,795,094 V3172A probably benign Het
Psme4 G T 11: 30,806,310 W272L probably damaging Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Rhobtb1 A C 10: 69,272,771 S434R probably benign Het
Rhobtb1 G C 10: 69,272,772 S434T possibly damaging Het
Rnf8 T C 17: 29,634,761 F413S probably damaging Het
Rpn2 A G 2: 157,314,968 N497S probably damaging Het
Rsbn1l G T 5: 20,951,490 P99Q probably benign Het
Serpinb3b A T 1: 107,155,434 M246K probably benign Het
Sgsm2 T C 11: 74,896,826 E19G probably null Het
Shank1 A G 7: 44,319,737 H352R unknown Het
Slc17a7 A G 7: 45,170,304 I177V probably benign Het
Slc28a2 T A 2: 122,451,013 F228I probably damaging Het
Slc35b4 C T 6: 34,170,549 V35I probably benign Het
Slc38a1 T C 15: 96,578,760 I407V probably damaging Het
Slc39a13 A G 2: 91,063,097 V326A probably damaging Het
Slc44a5 T C 3: 154,239,106 L120P probably damaging Het
Slfn3 T C 11: 83,213,314 I214T probably damaging Het
Slitrk3 A C 3: 73,049,691 S583A probably benign Het
Snx14 T C 9: 88,415,675 Y180C probably damaging Het
Sorl1 T A 9: 41,996,242 K1483I probably benign Het
Ssrp1 C A 2: 85,040,760 H247N probably damaging Het
Stk39 A T 2: 68,307,116 probably benign Het
Syde1 C T 10: 78,585,696 G674R probably damaging Het
Themis3 G A 17: 66,555,853 S370L probably benign Het
Tll1 T A 8: 64,101,873 N259Y probably damaging Het
Tnip2 T G 5: 34,503,831 probably benign Het
Top2b T C 14: 16,409,823 V830A probably benign Het
Trpm8 T A 1: 88,365,080 N934K probably damaging Het
Ttc14 A G 3: 33,802,920 Y179C probably damaging Het
Ttn T G 2: 76,743,621 I17316L possibly damaging Het
Tufm T C 7: 126,487,699 V52A probably benign Het
Vamp8 T A 6: 72,388,287 N20I probably benign Het
Vmn1r170 A T 7: 23,606,863 H230L probably benign Het
Vmn2r50 T G 7: 10,037,804 T657P probably damaging Het
Xirp2 G A 2: 67,512,418 G1668R probably benign Het
Zik1 C A 7: 10,490,384 R262L possibly damaging Het
Zscan25 T G 5: 145,283,691 Y99D probably damaging Het
Other mutations in Dab2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Dab2 APN 15 6429825 missense probably benign 0.00
IGL00731:Dab2 APN 15 6435710 missense possibly damaging 0.95
IGL02382:Dab2 APN 15 6436987 missense possibly damaging 0.62
IGL02598:Dab2 APN 15 6429366 missense probably damaging 0.97
IGL03054:Dab2 APN 15 6418226 unclassified probably benign
IGL03093:Dab2 APN 15 6436411 missense probably damaging 1.00
IGL03369:Dab2 APN 15 6435309 missense possibly damaging 0.64
IGL03372:Dab2 APN 15 6429549 missense probably damaging 0.99
R0157:Dab2 UTSW 15 6429827 missense probably benign 0.00
R0326:Dab2 UTSW 15 6418316 missense probably damaging 1.00
R0488:Dab2 UTSW 15 6424654 missense probably damaging 1.00
R0552:Dab2 UTSW 15 6435414 missense possibly damaging 0.65
R0938:Dab2 UTSW 15 6435384 missense probably benign 0.04
R1433:Dab2 UTSW 15 6429938 missense probably damaging 1.00
R1635:Dab2 UTSW 15 6429870 missense possibly damaging 0.80
R1757:Dab2 UTSW 15 6330452 intron probably benign
R1800:Dab2 UTSW 15 6435467 missense probably benign
R1837:Dab2 UTSW 15 6336476 intron probably benign
R1999:Dab2 UTSW 15 6416917 missense probably benign 0.32
R2050:Dab2 UTSW 15 6435215 missense possibly damaging 0.47
R2117:Dab2 UTSW 15 6435615 missense probably damaging 1.00
R2129:Dab2 UTSW 15 6336383 nonsense probably null
R2150:Dab2 UTSW 15 6416917 missense probably benign 0.32
R2329:Dab2 UTSW 15 6429563 missense possibly damaging 0.80
R2338:Dab2 UTSW 15 6435252 missense possibly damaging 0.62
R2680:Dab2 UTSW 15 6436993 missense possibly damaging 0.89
R3978:Dab2 UTSW 15 6435163 critical splice acceptor site probably null
R3979:Dab2 UTSW 15 6435163 critical splice acceptor site probably null
R3980:Dab2 UTSW 15 6435163 critical splice acceptor site probably null
R4551:Dab2 UTSW 15 6435294 missense probably damaging 0.97
R4795:Dab2 UTSW 15 6429611 missense probably benign 0.16
R4829:Dab2 UTSW 15 6424681 missense probably damaging 1.00
R4830:Dab2 UTSW 15 6427527 missense probably benign
R4832:Dab2 UTSW 15 6336599 intron probably null
R5168:Dab2 UTSW 15 6336443 intron probably benign
R5620:Dab2 UTSW 15 6418315 missense probably damaging 0.98
R5996:Dab2 UTSW 15 6435311 nonsense probably null
R6159:Dab2 UTSW 15 6436460 missense possibly damaging 0.93
R6998:Dab2 UTSW 15 6424649 missense possibly damaging 0.49
R7002:Dab2 UTSW 15 6435365 missense probably benign 0.01
R7040:Dab2 UTSW 15 6422251 missense probably damaging 1.00
R7138:Dab2 UTSW 15 6429299 missense probably benign 0.24
R7448:Dab2 UTSW 15 6422266 missense probably damaging 1.00
R7548:Dab2 UTSW 15 6429918 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- GAACGCCTTTTCTGCCAATCTCAAC -3'
(R):5'- GCTGAGGACTGGACAGAACTTTCC -3'

Sequencing Primer
(F):5'- GTGATGATCCCTTTGCACAG -3'
(R):5'- TGGACAGAACTTTCCAAGTCCTG -3'
Posted On2014-05-14