Incidental Mutation 'R1713:C4b'
ID190819
Institutional Source Beutler Lab
Gene Symbol C4b
Ensembl Gene ENSMUSG00000073418
Gene Namecomplement component 4B (Chido blood group)
SynonymsC4, Ss
MMRRC Submission 039746-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1713 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location34728380-34743882 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 34729271 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000069418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069507]
Predicted Effect probably benign
Transcript: ENSMUST00000069507
SMART Domains Protein: ENSMUSP00000069418
Gene: ENSMUSG00000073418

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:A2M_N 138 231 2e-19 PFAM
A2M_N_2 470 609 2.87e-26 SMART
ANATO 700 734 3.58e-12 SMART
low complexity region 761 771 N/A INTRINSIC
A2M 779 867 1.46e-27 SMART
Pfam:Thiol-ester_cl 995 1024 7.7e-13 PFAM
Pfam:A2M_comp 1047 1313 1.3e-82 PFAM
low complexity region 1441 1447 N/A INTRINSIC
A2M_recep 1475 1564 1.03e-36 SMART
C345C 1608 1720 5.69e-40 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173669
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 98% (96/98)
MGI Phenotype PHENOTYPE: Homozygous C4 deficient mice have compromised immune responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik T A 4: 103,270,767 I54F possibly damaging Het
Ackr1 A T 1: 173,332,349 H134Q probably benign Het
Agtr1b A T 3: 20,316,309 F44L probably benign Het
Ahnak G A 19: 9,011,809 D3486N possibly damaging Het
Akap9 T C 5: 4,039,345 probably null Het
Anks6 T A 4: 47,039,726 Q495L probably benign Het
Arpp21 A G 9: 112,067,169 S684P probably damaging Het
Ash1l A G 3: 89,076,224 E2911G probably damaging Het
Avpi1 C T 19: 42,124,809 E70K probably damaging Het
Btbd17 G T 11: 114,795,824 P9T probably benign Het
Carm1 T C 9: 21,586,489 V385A probably damaging Het
Casd1 A G 6: 4,624,104 D299G probably damaging Het
Clca1 T A 3: 145,024,546 K179N probably benign Het
Col1a2 T C 6: 4,538,691 S1204P unknown Het
Col24a1 C T 3: 145,366,869 Q780* probably null Het
Cxadr C A 16: 78,334,245 N216K probably damaging Het
Daam1 C T 12: 71,895,882 T40I unknown Het
Dab2 C T 15: 6,429,701 P365S possibly damaging Het
Dnah1 A T 14: 31,279,182 I2402N probably damaging Het
Dscaml1 T A 9: 45,752,690 S1954R possibly damaging Het
Dync2h1 T C 9: 7,131,891 T1639A probably benign Het
Ebf1 A T 11: 44,924,566 I336F probably damaging Het
Ebna1bp2 A G 4: 118,625,684 N290S possibly damaging Het
Gabra2 A G 5: 71,014,563 I110T probably benign Het
Galk2 A G 2: 125,931,290 N203S probably benign Het
Gria4 T C 9: 4,424,448 T806A probably benign Het
Impg2 A G 16: 56,260,526 T789A probably benign Het
Itga6 A G 2: 71,787,202 T22A probably benign Het
Itgb4 T A 11: 116,003,489 I1312N probably damaging Het
Kdm4c A G 4: 74,298,484 D160G probably benign Het
Kdr A G 5: 75,968,467 V173A probably benign Het
Kif14 T C 1: 136,527,464 S1575P probably benign Het
Lcp1 G A 14: 75,199,444 probably null Het
Lipe C A 7: 25,385,325 S516I probably damaging Het
Lrrc61 G A 6: 48,568,774 R177Q possibly damaging Het
Macf1 A G 4: 123,378,694 I6429T probably damaging Het
Map3k4 C T 17: 12,249,571 E1012K probably benign Het
Map3k5 T C 10: 20,110,847 F936L possibly damaging Het
Mllt3 A T 4: 87,783,664 N497K probably damaging Het
Moxd1 G A 10: 24,281,496 G342D probably damaging Het
Mtdh A C 15: 34,114,839 Q202H possibly damaging Het
Nav1 A G 1: 135,595,234 probably benign Het
Nop56 T C 2: 130,277,966 V109A possibly damaging Het
Obscn T C 11: 59,079,886 D2540G probably damaging Het
Olfr1121 A T 2: 87,371,946 Y138F probably damaging Het
Olfr1495 A T 19: 13,769,295 T318S probably benign Het
Omg T C 11: 79,502,853 I60V probably benign Het
Osbpl5 G A 7: 143,694,373 H652Y probably damaging Het
Papd7 A T 13: 69,503,051 I565N probably benign Het
Parvb T C 15: 84,297,991 probably benign Het
Pcdhb3 A C 18: 37,303,322 E780D probably benign Het
Pik3c3 A G 18: 30,323,586 D723G possibly damaging Het
Prkdc T C 16: 15,795,094 V3172A probably benign Het
Psme4 G T 11: 30,806,310 W272L probably damaging Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Rhobtb1 A C 10: 69,272,771 S434R probably benign Het
Rhobtb1 G C 10: 69,272,772 S434T possibly damaging Het
Rnf8 T C 17: 29,634,761 F413S probably damaging Het
Rpn2 A G 2: 157,314,968 N497S probably damaging Het
Rsbn1l G T 5: 20,951,490 P99Q probably benign Het
Serpinb3b A T 1: 107,155,434 M246K probably benign Het
Sgsm2 T C 11: 74,896,826 E19G probably null Het
Shank1 A G 7: 44,319,737 H352R unknown Het
Slc17a7 A G 7: 45,170,304 I177V probably benign Het
Slc28a2 T A 2: 122,451,013 F228I probably damaging Het
Slc35b4 C T 6: 34,170,549 V35I probably benign Het
Slc38a1 T C 15: 96,578,760 I407V probably damaging Het
Slc39a13 A G 2: 91,063,097 V326A probably damaging Het
Slc44a5 T C 3: 154,239,106 L120P probably damaging Het
Slfn3 T C 11: 83,213,314 I214T probably damaging Het
Slitrk3 A C 3: 73,049,691 S583A probably benign Het
Snx14 T C 9: 88,415,675 Y180C probably damaging Het
Sorl1 T A 9: 41,996,242 K1483I probably benign Het
Ssrp1 C A 2: 85,040,760 H247N probably damaging Het
Stk39 A T 2: 68,307,116 probably benign Het
Syde1 C T 10: 78,585,696 G674R probably damaging Het
Themis3 G A 17: 66,555,853 S370L probably benign Het
Tll1 T A 8: 64,101,873 N259Y probably damaging Het
Tnip2 T G 5: 34,503,831 probably benign Het
Top2b T C 14: 16,409,823 V830A probably benign Het
Trpm8 T A 1: 88,365,080 N934K probably damaging Het
Ttc14 A G 3: 33,802,920 Y179C probably damaging Het
Ttn T G 2: 76,743,621 I17316L possibly damaging Het
Tufm T C 7: 126,487,699 V52A probably benign Het
Vamp8 T A 6: 72,388,287 N20I probably benign Het
Vmn1r170 A T 7: 23,606,863 H230L probably benign Het
Vmn2r50 T G 7: 10,037,804 T657P probably damaging Het
Xirp2 G A 2: 67,512,418 G1668R probably benign Het
Zik1 C A 7: 10,490,384 R262L possibly damaging Het
Zscan25 T G 5: 145,283,691 Y99D probably damaging Het
Other mutations in C4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:C4b APN 17 34734428 missense probably damaging 1.00
IGL00433:C4b APN 17 34742041 missense possibly damaging 0.75
IGL00471:C4b APN 17 34734429 missense probably damaging 1.00
IGL00515:C4b APN 17 34728891 missense probably damaging 1.00
IGL01599:C4b APN 17 34743019 splice site probably benign
IGL01761:C4b APN 17 34739938 missense possibly damaging 0.56
IGL02004:C4b APN 17 34739010 unclassified probably benign
IGL02215:C4b APN 17 34734491 missense probably damaging 1.00
IGL02517:C4b APN 17 34734408 missense probably benign 0.01
IGL02926:C4b APN 17 34730712 missense possibly damaging 0.95
IGL03031:C4b APN 17 34731130 missense possibly damaging 0.47
IGL03057:C4b APN 17 34737764 unclassified probably benign
IGL03165:C4b APN 17 34739955 missense probably benign 0.13
IGL03380:C4b APN 17 34740286 missense probably benign 0.01
Aspiration UTSW 17 34734442 missense probably benign 0.00
Inspiration UTSW 17 34732166 splice site probably null
perspiration UTSW 17 34729831 missense probably damaging 1.00
FR4548:C4b UTSW 17 34740997 missense probably benign 0.00
PIT4142001:C4b UTSW 17 34733701 missense probably benign 0.01
R0064:C4b UTSW 17 34738856 missense probably damaging 1.00
R0113:C4b UTSW 17 34741240 missense probably damaging 0.98
R0143:C4b UTSW 17 34734219 unclassified probably benign
R0254:C4b UTSW 17 34734776 missense probably benign 0.00
R0320:C4b UTSW 17 34733161 missense probably benign 0.01
R0391:C4b UTSW 17 34735614 splice site probably benign
R0399:C4b UTSW 17 34728869 missense probably damaging 1.00
R0467:C4b UTSW 17 34736127 missense probably benign 0.01
R0549:C4b UTSW 17 34735415 missense probably damaging 1.00
R0561:C4b UTSW 17 34734417 missense probably damaging 0.99
R0662:C4b UTSW 17 34730888 missense probably damaging 1.00
R0941:C4b UTSW 17 34740055 missense probably benign
R1161:C4b UTSW 17 34729593 missense probably damaging 1.00
R1169:C4b UTSW 17 34742972 missense probably benign 0.14
R1186:C4b UTSW 17 34736309 missense possibly damaging 0.47
R1310:C4b UTSW 17 34729593 missense probably damaging 1.00
R1398:C4b UTSW 17 34730719 unclassified probably benign
R1472:C4b UTSW 17 34743769 nonsense probably null
R1496:C4b UTSW 17 34740021 missense probably benign 0.30
R1544:C4b UTSW 17 34738967 missense probably benign 0.13
R1588:C4b UTSW 17 34741025 missense probably benign
R1645:C4b UTSW 17 34740597 missense probably damaging 1.00
R1664:C4b UTSW 17 34732978 missense probably damaging 1.00
R1678:C4b UTSW 17 34743650 missense probably benign 0.05
R1710:C4b UTSW 17 34743664 splice site probably benign
R1770:C4b UTSW 17 34736927 missense possibly damaging 0.78
R1859:C4b UTSW 17 34735553 missense probably benign
R1924:C4b UTSW 17 34729657 missense probably damaging 1.00
R2057:C4b UTSW 17 34728620 missense probably damaging 1.00
R2060:C4b UTSW 17 34736101 missense probably damaging 1.00
R2184:C4b UTSW 17 34737702 missense probably benign 0.27
R2306:C4b UTSW 17 34728518 missense probably benign 0.00
R2363:C4b UTSW 17 34736058 splice site probably benign
R2365:C4b UTSW 17 34736058 splice site probably benign
R2379:C4b UTSW 17 34735743 missense possibly damaging 0.81
R2860:C4b UTSW 17 34734758 missense probably damaging 0.99
R2861:C4b UTSW 17 34734758 missense probably damaging 0.99
R3551:C4b UTSW 17 34741872 missense possibly damaging 0.75
R3765:C4b UTSW 17 34729840 missense probably damaging 0.98
R4157:C4b UTSW 17 34742855 missense probably damaging 1.00
R4299:C4b UTSW 17 34731144 missense possibly damaging 0.52
R4365:C4b UTSW 17 34734743 missense possibly damaging 0.65
R4411:C4b UTSW 17 34728864 missense probably damaging 1.00
R4613:C4b UTSW 17 34734551 missense probably benign 0.12
R4784:C4b UTSW 17 34733406 missense probably benign 0.00
R4790:C4b UTSW 17 34734143 missense probably benign 0.01
R4831:C4b UTSW 17 34736890 splice site probably null
R4879:C4b UTSW 17 34743647 missense probably damaging 0.99
R5036:C4b UTSW 17 34740445 critical splice acceptor site probably null
R5361:C4b UTSW 17 34741238 missense probably benign 0.15
R5384:C4b UTSW 17 34737661 missense possibly damaging 0.89
R5518:C4b UTSW 17 34734442 missense probably benign 0.00
R5590:C4b UTSW 17 34740335 missense probably damaging 0.98
R5643:C4b UTSW 17 34742417 missense probably benign 0.01
R5644:C4b UTSW 17 34742417 missense probably benign 0.01
R5833:C4b UTSW 17 34730673 missense probably damaging 1.00
R5931:C4b UTSW 17 34729193 missense probably damaging 0.99
R6178:C4b UTSW 17 34733406 missense probably benign 0.00
R6209:C4b UTSW 17 34741087 missense possibly damaging 0.93
R6225:C4b UTSW 17 34738874 missense possibly damaging 0.64
R6518:C4b UTSW 17 34734205 missense probably damaging 0.98
R6613:C4b UTSW 17 34733565 missense probably damaging 0.99
R6781:C4b UTSW 17 34742954 missense probably damaging 0.99
R6807:C4b UTSW 17 34730956 missense probably benign 0.17
R6858:C4b UTSW 17 34729831 missense probably damaging 1.00
R6962:C4b UTSW 17 34732166 splice site probably null
R7068:C4b UTSW 17 34733477 missense probably damaging 1.00
R7081:C4b UTSW 17 34735443 missense probably benign 0.27
R7105:C4b UTSW 17 34730911 missense possibly damaging 0.52
R7211:C4b UTSW 17 34735534 missense possibly damaging 0.92
R7296:C4b UTSW 17 34743659 missense probably damaging 1.00
R7314:C4b UTSW 17 34740356 missense probably benign
R7330:C4b UTSW 17 34730472 missense probably damaging 1.00
R7397:C4b UTSW 17 34742390 missense possibly damaging 0.80
R7437:C4b UTSW 17 34734733 missense probably benign 0.10
R7490:C4b UTSW 17 34731080 nonsense probably null
R7597:C4b UTSW 17 34739675 missense probably benign
R7633:C4b UTSW 17 34729399 critical splice donor site probably null
R7900:C4b UTSW 17 34739777 missense probably benign 0.03
R7910:C4b UTSW 17 34740352 missense probably benign 0.00
R7983:C4b UTSW 17 34739777 missense probably benign 0.03
R7991:C4b UTSW 17 34740352 missense probably benign 0.00
Z1176:C4b UTSW 17 34731147 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CGTTGCTTCCTACAGAACTTGTTGC -3'
(R):5'- TTATCCCCGAGTGGAGTATGGTCAG -3'

Sequencing Primer
(F):5'- GCAAGCCCAGGTTCCTAATG -3'
(R):5'- AGTGGAGTATGGTCAGTCCCTC -3'
Posted On2014-05-14