Incidental Mutation 'R1713:C4b'
ID 190819
Institutional Source Beutler Lab
Gene Symbol C4b
Ensembl Gene ENSMUSG00000073418
Gene Name complement C4B (Chido blood group)
Synonyms Ss, C4
MMRRC Submission 039746-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1713 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 34947354-34962856 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to G at 34948245 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000069418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069507]
AlphaFold P01029
Predicted Effect probably benign
Transcript: ENSMUST00000069507
SMART Domains Protein: ENSMUSP00000069418
Gene: ENSMUSG00000073418

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:A2M_N 138 231 2e-19 PFAM
A2M_N_2 470 609 2.87e-26 SMART
ANATO 700 734 3.58e-12 SMART
low complexity region 761 771 N/A INTRINSIC
A2M 779 867 1.46e-27 SMART
Pfam:Thiol-ester_cl 995 1024 7.7e-13 PFAM
Pfam:A2M_comp 1047 1313 1.3e-82 PFAM
low complexity region 1441 1447 N/A INTRINSIC
A2M_recep 1475 1564 1.03e-36 SMART
C345C 1608 1720 5.69e-40 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173669
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 98% (96/98)
MGI Phenotype PHENOTYPE: Homozygous C4 deficient mice have compromised immune responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik T A 4: 103,127,964 (GRCm39) I54F possibly damaging Het
Ackr1 A T 1: 173,159,916 (GRCm39) H134Q probably benign Het
Agtr1b A T 3: 20,370,473 (GRCm39) F44L probably benign Het
Ahnak G A 19: 8,989,173 (GRCm39) D3486N possibly damaging Het
Akap9 T C 5: 4,089,345 (GRCm39) probably null Het
Anks6 T A 4: 47,039,726 (GRCm39) Q495L probably benign Het
Arpp21 A G 9: 111,896,237 (GRCm39) S684P probably damaging Het
Ash1l A G 3: 88,983,531 (GRCm39) E2911G probably damaging Het
Avpi1 C T 19: 42,113,248 (GRCm39) E70K probably damaging Het
Btbd17 G T 11: 114,686,650 (GRCm39) P9T probably benign Het
Carm1 T C 9: 21,497,785 (GRCm39) V385A probably damaging Het
Casd1 A G 6: 4,624,104 (GRCm39) D299G probably damaging Het
Clca3a1 T A 3: 144,730,307 (GRCm39) K179N probably benign Het
Col1a2 T C 6: 4,538,691 (GRCm39) S1204P unknown Het
Col24a1 C T 3: 145,072,624 (GRCm39) Q780* probably null Het
Cxadr C A 16: 78,131,133 (GRCm39) N216K probably damaging Het
Daam1 C T 12: 71,942,656 (GRCm39) T40I unknown Het
Dab2 C T 15: 6,459,182 (GRCm39) P365S possibly damaging Het
Dnah1 A T 14: 31,001,139 (GRCm39) I2402N probably damaging Het
Dscaml1 T A 9: 45,663,988 (GRCm39) S1954R possibly damaging Het
Dync2h1 T C 9: 7,131,891 (GRCm39) T1639A probably benign Het
Ebf1 A T 11: 44,815,393 (GRCm39) I336F probably damaging Het
Ebna1bp2 A G 4: 118,482,881 (GRCm39) N290S possibly damaging Het
Gabra2 A G 5: 71,171,906 (GRCm39) I110T probably benign Het
Galk2 A G 2: 125,773,210 (GRCm39) N203S probably benign Het
Gria4 T C 9: 4,424,448 (GRCm39) T806A probably benign Het
Impg2 A G 16: 56,080,889 (GRCm39) T789A probably benign Het
Itga6 A G 2: 71,617,546 (GRCm39) T22A probably benign Het
Itgb4 T A 11: 115,894,315 (GRCm39) I1312N probably damaging Het
Kdm4c A G 4: 74,216,721 (GRCm39) D160G probably benign Het
Kdr A G 5: 76,129,127 (GRCm39) V173A probably benign Het
Kif14 T C 1: 136,455,202 (GRCm39) S1575P probably benign Het
Lcp1 G A 14: 75,436,884 (GRCm39) probably null Het
Lipe C A 7: 25,084,750 (GRCm39) S516I probably damaging Het
Lrrc61 G A 6: 48,545,708 (GRCm39) R177Q possibly damaging Het
Macf1 A G 4: 123,272,487 (GRCm39) I6429T probably damaging Het
Map3k4 C T 17: 12,468,458 (GRCm39) E1012K probably benign Het
Map3k5 T C 10: 19,986,593 (GRCm39) F936L possibly damaging Het
Mllt3 A T 4: 87,701,901 (GRCm39) N497K probably damaging Het
Moxd1 G A 10: 24,157,394 (GRCm39) G342D probably damaging Het
Mtdh A C 15: 34,114,985 (GRCm39) Q202H possibly damaging Het
Nav1 A G 1: 135,522,972 (GRCm39) probably benign Het
Nop56 T C 2: 130,119,886 (GRCm39) V109A possibly damaging Het
Obscn T C 11: 58,970,712 (GRCm39) D2540G probably damaging Het
Omg T C 11: 79,393,679 (GRCm39) I60V probably benign Het
Or10q12 A T 19: 13,746,659 (GRCm39) T318S probably benign Het
Or12e9 A T 2: 87,202,290 (GRCm39) Y138F probably damaging Het
Osbpl5 G A 7: 143,248,110 (GRCm39) H652Y probably damaging Het
Parvb T C 15: 84,182,192 (GRCm39) probably benign Het
Pcdhb3 A C 18: 37,436,375 (GRCm39) E780D probably benign Het
Pik3c3 A G 18: 30,456,639 (GRCm39) D723G possibly damaging Het
Prkdc T C 16: 15,612,958 (GRCm39) V3172A probably benign Het
Psme4 G T 11: 30,756,310 (GRCm39) W272L probably damaging Het
Rem1 G A 2: 152,476,455 (GRCm39) V238M probably damaging Het
Rhobtb1 A C 10: 69,108,601 (GRCm39) S434R probably benign Het
Rhobtb1 G C 10: 69,108,602 (GRCm39) S434T possibly damaging Het
Rnf8 T C 17: 29,853,735 (GRCm39) F413S probably damaging Het
Rpn2 A G 2: 157,156,888 (GRCm39) N497S probably damaging Het
Rsbn1l G T 5: 21,156,488 (GRCm39) P99Q probably benign Het
Serpinb3b A T 1: 107,083,164 (GRCm39) M246K probably benign Het
Sgsm2 T C 11: 74,787,652 (GRCm39) E19G probably null Het
Shank1 A G 7: 43,969,161 (GRCm39) H352R unknown Het
Slc17a7 A G 7: 44,819,728 (GRCm39) I177V probably benign Het
Slc28a2 T A 2: 122,281,494 (GRCm39) F228I probably damaging Het
Slc35b4 C T 6: 34,147,484 (GRCm39) V35I probably benign Het
Slc38a1 T C 15: 96,476,641 (GRCm39) I407V probably damaging Het
Slc39a13 A G 2: 90,893,442 (GRCm39) V326A probably damaging Het
Slc44a5 T C 3: 153,944,743 (GRCm39) L120P probably damaging Het
Slfn3 T C 11: 83,104,140 (GRCm39) I214T probably damaging Het
Slitrk3 A C 3: 72,957,024 (GRCm39) S583A probably benign Het
Snx14 T C 9: 88,297,728 (GRCm39) Y180C probably damaging Het
Sorl1 T A 9: 41,907,538 (GRCm39) K1483I probably benign Het
Ssrp1 C A 2: 84,871,104 (GRCm39) H247N probably damaging Het
Stk39 A T 2: 68,137,460 (GRCm39) probably benign Het
Syde1 C T 10: 78,421,530 (GRCm39) G674R probably damaging Het
Tent4a A T 13: 69,651,170 (GRCm39) I565N probably benign Het
Themis3 G A 17: 66,862,848 (GRCm39) S370L probably benign Het
Tll1 T A 8: 64,554,907 (GRCm39) N259Y probably damaging Het
Tnip2 T G 5: 34,661,175 (GRCm39) probably benign Het
Top2b T C 14: 16,409,823 (GRCm38) V830A probably benign Het
Trpm8 T A 1: 88,292,802 (GRCm39) N934K probably damaging Het
Ttc14 A G 3: 33,857,069 (GRCm39) Y179C probably damaging Het
Ttn T G 2: 76,573,965 (GRCm39) I17316L possibly damaging Het
Tufm T C 7: 126,086,871 (GRCm39) V52A probably benign Het
Vamp8 T A 6: 72,365,270 (GRCm39) N20I probably benign Het
Vmn1r170 A T 7: 23,306,288 (GRCm39) H230L probably benign Het
Vmn2r50 T G 7: 9,771,731 (GRCm39) T657P probably damaging Het
Xirp2 G A 2: 67,342,762 (GRCm39) G1668R probably benign Het
Zik1 C A 7: 10,224,311 (GRCm39) R262L possibly damaging Het
Zscan25 T G 5: 145,220,501 (GRCm39) Y99D probably damaging Het
Other mutations in C4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:C4b APN 17 34,953,402 (GRCm39) missense probably damaging 1.00
IGL00433:C4b APN 17 34,961,015 (GRCm39) missense possibly damaging 0.75
IGL00471:C4b APN 17 34,953,403 (GRCm39) missense probably damaging 1.00
IGL00515:C4b APN 17 34,947,865 (GRCm39) missense probably damaging 1.00
IGL01599:C4b APN 17 34,961,993 (GRCm39) splice site probably benign
IGL01761:C4b APN 17 34,958,912 (GRCm39) missense possibly damaging 0.56
IGL02004:C4b APN 17 34,957,984 (GRCm39) unclassified probably benign
IGL02215:C4b APN 17 34,953,465 (GRCm39) missense probably damaging 1.00
IGL02517:C4b APN 17 34,953,382 (GRCm39) missense probably benign 0.01
IGL02926:C4b APN 17 34,949,686 (GRCm39) missense possibly damaging 0.95
IGL03031:C4b APN 17 34,950,104 (GRCm39) missense possibly damaging 0.47
IGL03057:C4b APN 17 34,956,738 (GRCm39) unclassified probably benign
IGL03165:C4b APN 17 34,958,929 (GRCm39) missense probably benign 0.13
IGL03380:C4b APN 17 34,959,260 (GRCm39) missense probably benign 0.01
Aspiration UTSW 17 34,953,416 (GRCm39) missense probably benign 0.00
Inspiration UTSW 17 34,951,140 (GRCm39) splice site probably null
Peroration UTSW 17 34,948,373 (GRCm39) critical splice donor site probably null
perspiration UTSW 17 34,948,805 (GRCm39) missense probably damaging 1.00
FR4548:C4b UTSW 17 34,959,971 (GRCm39) missense probably benign 0.00
PIT4142001:C4b UTSW 17 34,952,675 (GRCm39) missense probably benign 0.01
R0064:C4b UTSW 17 34,957,830 (GRCm39) missense probably damaging 1.00
R0113:C4b UTSW 17 34,960,214 (GRCm39) missense probably damaging 0.98
R0143:C4b UTSW 17 34,953,193 (GRCm39) unclassified probably benign
R0254:C4b UTSW 17 34,953,750 (GRCm39) missense probably benign 0.00
R0320:C4b UTSW 17 34,952,135 (GRCm39) missense probably benign 0.01
R0391:C4b UTSW 17 34,954,588 (GRCm39) splice site probably benign
R0399:C4b UTSW 17 34,947,843 (GRCm39) missense probably damaging 1.00
R0467:C4b UTSW 17 34,955,101 (GRCm39) missense probably benign 0.01
R0549:C4b UTSW 17 34,954,389 (GRCm39) missense probably damaging 1.00
R0561:C4b UTSW 17 34,953,391 (GRCm39) missense probably damaging 0.99
R0662:C4b UTSW 17 34,949,862 (GRCm39) missense probably damaging 1.00
R0941:C4b UTSW 17 34,959,029 (GRCm39) missense probably benign
R1161:C4b UTSW 17 34,948,567 (GRCm39) missense probably damaging 1.00
R1169:C4b UTSW 17 34,961,946 (GRCm39) missense probably benign 0.14
R1186:C4b UTSW 17 34,955,283 (GRCm39) missense possibly damaging 0.47
R1310:C4b UTSW 17 34,948,567 (GRCm39) missense probably damaging 1.00
R1398:C4b UTSW 17 34,949,693 (GRCm39) unclassified probably benign
R1472:C4b UTSW 17 34,962,743 (GRCm39) nonsense probably null
R1496:C4b UTSW 17 34,958,995 (GRCm39) missense probably benign 0.30
R1544:C4b UTSW 17 34,957,941 (GRCm39) missense probably benign 0.13
R1588:C4b UTSW 17 34,959,999 (GRCm39) missense probably benign
R1645:C4b UTSW 17 34,959,571 (GRCm39) missense probably damaging 1.00
R1664:C4b UTSW 17 34,951,952 (GRCm39) missense probably damaging 1.00
R1678:C4b UTSW 17 34,962,624 (GRCm39) missense probably benign 0.05
R1710:C4b UTSW 17 34,962,638 (GRCm39) splice site probably benign
R1770:C4b UTSW 17 34,955,901 (GRCm39) missense possibly damaging 0.78
R1859:C4b UTSW 17 34,954,527 (GRCm39) missense probably benign
R1924:C4b UTSW 17 34,948,631 (GRCm39) missense probably damaging 1.00
R2057:C4b UTSW 17 34,947,594 (GRCm39) missense probably damaging 1.00
R2060:C4b UTSW 17 34,955,075 (GRCm39) missense probably damaging 1.00
R2184:C4b UTSW 17 34,956,676 (GRCm39) missense probably benign 0.27
R2306:C4b UTSW 17 34,947,492 (GRCm39) missense probably benign 0.00
R2363:C4b UTSW 17 34,955,032 (GRCm39) splice site probably benign
R2365:C4b UTSW 17 34,955,032 (GRCm39) splice site probably benign
R2379:C4b UTSW 17 34,954,717 (GRCm39) missense possibly damaging 0.81
R2860:C4b UTSW 17 34,953,732 (GRCm39) missense probably damaging 0.99
R2861:C4b UTSW 17 34,953,732 (GRCm39) missense probably damaging 0.99
R3551:C4b UTSW 17 34,960,846 (GRCm39) missense possibly damaging 0.75
R3765:C4b UTSW 17 34,948,814 (GRCm39) missense probably damaging 0.98
R4157:C4b UTSW 17 34,961,829 (GRCm39) missense probably damaging 1.00
R4299:C4b UTSW 17 34,950,118 (GRCm39) missense possibly damaging 0.52
R4365:C4b UTSW 17 34,953,717 (GRCm39) missense possibly damaging 0.65
R4411:C4b UTSW 17 34,947,838 (GRCm39) missense probably damaging 1.00
R4613:C4b UTSW 17 34,953,525 (GRCm39) missense probably benign 0.12
R4784:C4b UTSW 17 34,952,380 (GRCm39) missense probably benign 0.00
R4790:C4b UTSW 17 34,953,117 (GRCm39) missense probably benign 0.01
R4831:C4b UTSW 17 34,955,864 (GRCm39) splice site probably null
R4879:C4b UTSW 17 34,962,621 (GRCm39) missense probably damaging 0.99
R5036:C4b UTSW 17 34,959,419 (GRCm39) critical splice acceptor site probably null
R5361:C4b UTSW 17 34,960,212 (GRCm39) missense probably benign 0.15
R5384:C4b UTSW 17 34,956,635 (GRCm39) missense possibly damaging 0.89
R5518:C4b UTSW 17 34,953,416 (GRCm39) missense probably benign 0.00
R5590:C4b UTSW 17 34,959,309 (GRCm39) missense probably damaging 0.98
R5643:C4b UTSW 17 34,961,391 (GRCm39) missense probably benign 0.01
R5644:C4b UTSW 17 34,961,391 (GRCm39) missense probably benign 0.01
R5833:C4b UTSW 17 34,949,647 (GRCm39) missense probably damaging 1.00
R5931:C4b UTSW 17 34,948,167 (GRCm39) missense probably damaging 0.99
R6178:C4b UTSW 17 34,952,380 (GRCm39) missense probably benign 0.00
R6209:C4b UTSW 17 34,960,061 (GRCm39) missense possibly damaging 0.93
R6225:C4b UTSW 17 34,957,848 (GRCm39) missense possibly damaging 0.64
R6518:C4b UTSW 17 34,953,179 (GRCm39) missense probably damaging 0.98
R6613:C4b UTSW 17 34,952,539 (GRCm39) missense probably damaging 0.99
R6781:C4b UTSW 17 34,961,928 (GRCm39) missense probably damaging 0.99
R6807:C4b UTSW 17 34,949,930 (GRCm39) missense probably benign 0.17
R6858:C4b UTSW 17 34,948,805 (GRCm39) missense probably damaging 1.00
R6962:C4b UTSW 17 34,951,140 (GRCm39) splice site probably null
R7068:C4b UTSW 17 34,952,451 (GRCm39) missense probably damaging 1.00
R7081:C4b UTSW 17 34,954,417 (GRCm39) missense probably benign 0.27
R7105:C4b UTSW 17 34,949,885 (GRCm39) missense possibly damaging 0.52
R7211:C4b UTSW 17 34,954,508 (GRCm39) missense possibly damaging 0.92
R7296:C4b UTSW 17 34,962,633 (GRCm39) missense probably damaging 1.00
R7314:C4b UTSW 17 34,959,330 (GRCm39) missense probably benign
R7330:C4b UTSW 17 34,949,446 (GRCm39) missense probably damaging 1.00
R7397:C4b UTSW 17 34,961,364 (GRCm39) missense possibly damaging 0.80
R7437:C4b UTSW 17 34,953,707 (GRCm39) missense probably benign 0.10
R7490:C4b UTSW 17 34,950,054 (GRCm39) nonsense probably null
R7597:C4b UTSW 17 34,958,649 (GRCm39) missense probably benign
R7633:C4b UTSW 17 34,948,373 (GRCm39) critical splice donor site probably null
R7900:C4b UTSW 17 34,958,751 (GRCm39) missense probably benign 0.03
R7910:C4b UTSW 17 34,959,326 (GRCm39) missense probably benign 0.00
R7923:C4b UTSW 17 34,961,354 (GRCm39) missense probably damaging 1.00
R7960:C4b UTSW 17 34,960,252 (GRCm39) splice site probably null
R8420:C4b UTSW 17 34,953,513 (GRCm39) missense probably damaging 0.97
R8467:C4b UTSW 17 34,951,787 (GRCm39) missense possibly damaging 0.51
R8558:C4b UTSW 17 34,955,541 (GRCm39) missense probably damaging 1.00
R8725:C4b UTSW 17 34,953,459 (GRCm39) missense probably damaging 1.00
R8727:C4b UTSW 17 34,953,459 (GRCm39) missense probably damaging 1.00
R8853:C4b UTSW 17 34,948,879 (GRCm39) missense possibly damaging 0.91
R8934:C4b UTSW 17 34,951,958 (GRCm39) missense possibly damaging 0.78
R8944:C4b UTSW 17 34,961,913 (GRCm39) missense probably benign 0.00
R8960:C4b UTSW 17 34,952,892 (GRCm39) missense probably damaging 1.00
R8982:C4b UTSW 17 34,953,338 (GRCm39) critical splice donor site probably null
R9104:C4b UTSW 17 34,948,233 (GRCm39) missense probably benign 0.39
R9114:C4b UTSW 17 34,948,404 (GRCm39) missense probably damaging 0.99
R9348:C4b UTSW 17 34,952,159 (GRCm39) missense probably benign 0.01
R9428:C4b UTSW 17 34,949,885 (GRCm39) missense possibly damaging 0.52
R9533:C4b UTSW 17 34,956,698 (GRCm39) nonsense probably null
R9591:C4b UTSW 17 34,957,929 (GRCm39) missense probably benign 0.00
R9678:C4b UTSW 17 34,960,763 (GRCm39) critical splice donor site probably null
Z1176:C4b UTSW 17 34,950,121 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CGTTGCTTCCTACAGAACTTGTTGC -3'
(R):5'- TTATCCCCGAGTGGAGTATGGTCAG -3'

Sequencing Primer
(F):5'- GCAAGCCCAGGTTCCTAATG -3'
(R):5'- AGTGGAGTATGGTCAGTCCCTC -3'
Posted On 2014-05-14