Incidental Mutation 'R1714:Cr2'
ID 190831
Institutional Source Beutler Lab
Gene Symbol Cr2
Ensembl Gene ENSMUSG00000026616
Gene Name complement receptor 2
Synonyms C3DR, CD21, Cr-2, Cr1, Cr-1, CD35
MMRRC Submission 039747-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.142) question?
Stock # R1714 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 194819119-194859024 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 194833994 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 932 (F932I)
Ref Sequence ENSEMBL: ENSMUSP00000080938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082321] [ENSMUST00000193356] [ENSMUST00000193801] [ENSMUST00000195120] [ENSMUST00000210219]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000082321
AA Change: F932I

PolyPhen 2 Score 0.456 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000080938
Gene: ENSMUSG00000026616
AA Change: F932I

DomainStartEndE-ValueType
CCP 23 82 1.01e-11 SMART
CCP 91 147 9.1e-14 SMART
CCP 155 211 1.9e-16 SMART
CCP 216 272 1.6e-9 SMART
CCP 277 343 1.01e-11 SMART
CCP 352 407 1.2e-13 SMART
CCP 411 467 2.34e-16 SMART
CCP 472 523 1.24e0 SMART
CCP 528 594 4.48e-13 SMART
CCP 603 658 1.95e-13 SMART
CCP 718 778 1.75e-15 SMART
CCP 787 842 2.06e-12 SMART
CCP 850 906 7.92e-14 SMART
CCP 911 967 1.29e-13 SMART
transmembrane domain 975 997 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192604
Predicted Effect probably benign
Transcript: ENSMUST00000193356
AA Change: F635I

PolyPhen 2 Score 0.452 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000141706
Gene: ENSMUSG00000026616
AA Change: F635I

DomainStartEndE-ValueType
CCP 1 46 1.2e-1 SMART
CCP 55 110 5.9e-16 SMART
CCP 114 170 1.1e-18 SMART
CCP 175 226 6.1e-3 SMART
CCP 231 297 2.2e-15 SMART
CCP 306 361 9.4e-16 SMART
CCP 421 481 8.3e-18 SMART
CCP 490 545 1e-14 SMART
CCP 553 609 4e-16 SMART
CCP 614 670 6.2e-16 SMART
transmembrane domain 678 700 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193436
Predicted Effect probably benign
Transcript: ENSMUST00000193801
SMART Domains Protein: ENSMUSP00000141276
Gene: ENSMUSG00000026616

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195120
AA Change: F932I

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000141538
Gene: ENSMUSG00000026616
AA Change: F932I

DomainStartEndE-ValueType
CCP 23 82 4.9e-14 SMART
CCP 91 147 4.5e-16 SMART
CCP 155 211 9.1e-19 SMART
CCP 216 272 8e-12 SMART
CCP 277 343 5e-14 SMART
CCP 352 407 5.9e-16 SMART
CCP 411 467 1.1e-18 SMART
CCP 472 523 6.1e-3 SMART
CCP 528 594 2.2e-15 SMART
CCP 603 658 9.4e-16 SMART
CCP 718 778 8.3e-18 SMART
CCP 787 842 1e-14 SMART
CCP 850 906 4e-16 SMART
CCP 911 967 6.2e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000210219
AA Change: F1308I

PolyPhen 2 Score 0.287 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195737
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein, which functions as a receptor for Epstein-Barr virus (EBV) binding on B and T lymphocytes. Genetic variations in this gene are associated with susceptibility to systemic lupus erythematosus type 9 (SLEB9). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired humoral immune responses to T cell-dependent antigens, with limited affinity maturation, and reduced memory B cell and germinal center formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C T 13: 77,464,479 (GRCm39) T892I possibly damaging Het
Abcb11 A C 2: 69,136,925 (GRCm39) F179V probably damaging Het
Adgrg6 G T 10: 14,315,514 (GRCm39) Q597K possibly damaging Het
Ankmy1 G T 1: 92,812,916 (GRCm39) Y464* probably null Het
Apba1 G A 19: 23,922,316 (GRCm39) E795K possibly damaging Het
Aqp12 T A 1: 92,934,681 (GRCm39) V186D possibly damaging Het
Brd8 A T 18: 34,742,886 (GRCm39) S253R probably damaging Het
Cdc42se2 A T 11: 54,631,112 (GRCm39) S2R possibly damaging Het
Chd9 A C 8: 91,760,853 (GRCm39) probably benign Het
Clk4 C T 11: 51,171,245 (GRCm39) H219Y probably damaging Het
Cngb1 A G 8: 95,984,559 (GRCm39) Y417H probably damaging Het
Cxxc1 C A 18: 74,352,934 (GRCm39) R415S probably damaging Het
Dclk2 G A 3: 86,813,400 (GRCm39) A182V probably benign Het
Ddx11 T G 17: 66,455,754 (GRCm39) W718G probably damaging Het
Dmd A C X: 83,008,356 (GRCm39) T2069P probably benign Het
Dnai1 T C 4: 41,632,164 (GRCm39) F533L probably benign Het
Dnajc5b A T 3: 19,633,265 (GRCm39) R163* probably null Het
Dynll2 T A 11: 87,874,838 (GRCm39) probably null Het
Ercc5 A G 1: 44,206,499 (GRCm39) T471A probably benign Het
Fan1 T C 7: 64,016,435 (GRCm39) D563G probably benign Het
Fbxo34 A G 14: 47,766,658 (GRCm39) Y6C probably damaging Het
Fcrl5 T A 3: 87,353,713 (GRCm39) S353T probably damaging Het
Gabrb3 A T 7: 57,415,176 (GRCm39) Y82F probably damaging Het
Gm20939 C A 17: 95,183,234 (GRCm39) P157T probably damaging Het
H2bc1 T C 13: 24,117,935 (GRCm39) T69A probably benign Het
Haus3 A T 5: 34,321,041 (GRCm39) H468Q probably benign Het
Il20ra T C 10: 19,631,576 (GRCm39) V259A probably damaging Het
Isg15 A T 4: 156,284,414 (GRCm39) V38E probably damaging Het
Kcnq3 A G 15: 65,871,912 (GRCm39) S586P probably benign Het
Kl A T 5: 150,876,798 (GRCm39) Y206F probably benign Het
Klk1b24 C A 7: 43,840,939 (GRCm39) D122E probably damaging Het
Kmt2d A C 15: 98,760,831 (GRCm39) S840A unknown Het
Krt34 A G 11: 99,930,953 (GRCm39) S150P possibly damaging Het
Lamc3 A G 2: 31,830,769 (GRCm39) K1502R probably benign Het
Letm1 G T 5: 33,918,228 (GRCm39) R306S possibly damaging Het
Lnx1 C T 5: 74,768,398 (GRCm39) G397S probably null Het
Lrrc8c A G 5: 105,755,157 (GRCm39) T311A possibly damaging Het
Mpeg1 A T 19: 12,440,198 (GRCm39) D552V probably damaging Het
Myh11 C T 16: 14,054,232 (GRCm39) probably null Het
Ndufa9 T C 6: 126,799,154 (GRCm39) probably null Het
Or4e5 A C 14: 52,727,871 (GRCm39) probably null Het
Or4f4b A T 2: 111,314,008 (GRCm39) I78F probably damaging Het
Or8s8 G A 15: 98,354,614 (GRCm39) C141Y probably damaging Het
Polr3d A C 14: 70,678,755 (GRCm39) M117R possibly damaging Het
Ppp5c T C 7: 16,742,628 (GRCm39) I237V probably benign Het
Prrc2c G A 1: 162,504,945 (GRCm39) T2632M probably damaging Het
Ptprg C A 14: 12,213,697 (GRCm38) Q1022K probably damaging Het
Pus10 T A 11: 23,675,542 (GRCm39) H471Q probably damaging Het
Ralgapa1 A G 12: 55,689,174 (GRCm39) V1928A probably damaging Het
Rbpms2 CACT CACTACT 9: 65,558,947 (GRCm39) probably benign Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,558,948 (GRCm39) probably benign Het
Rfpl4 T G 7: 5,113,357 (GRCm39) T269P probably benign Het
Rgs10 A G 7: 128,004,946 (GRCm39) V72A probably damaging Het
Rsph1 T C 17: 31,474,190 (GRCm39) N289S probably benign Het
Sbk2 T C 7: 4,966,121 (GRCm39) D21G probably benign Het
Shbg A T 11: 69,507,983 (GRCm39) D127E possibly damaging Het
Spag16 A G 1: 69,882,164 (GRCm39) E52G probably damaging Het
Ssh2 G A 11: 77,344,850 (GRCm39) G945D possibly damaging Het
Sstr3 A T 15: 78,424,473 (GRCm39) D91E probably damaging Het
Syne2 C A 12: 76,101,713 (GRCm39) A669E probably benign Het
Traf3 A G 12: 111,208,907 (GRCm39) I109V probably benign Het
Ube2j1 A G 4: 33,049,886 (GRCm39) T295A probably damaging Het
Usp46 A G 5: 74,163,828 (GRCm39) V276A probably benign Het
Vmn1r200 T C 13: 22,579,640 (GRCm39) S139P possibly damaging Het
Ydjc G A 16: 16,965,663 (GRCm39) V143M probably damaging Het
Zfp169 T C 13: 48,652,330 (GRCm39) E29G probably benign Het
Zfp292 A G 4: 34,808,935 (GRCm39) S1370P probably damaging Het
Zfp763 C T 17: 33,238,591 (GRCm39) D185N probably damaging Het
Zfp827 A T 8: 79,787,202 (GRCm39) N123Y probably damaging Het
Zfp979 A T 4: 147,698,442 (GRCm39) I89N probably damaging Het
Zfr2 T C 10: 81,080,583 (GRCm39) L419P probably damaging Het
Other mutations in Cr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Cr2 APN 1 194,836,559 (GRCm39) missense possibly damaging 0.76
IGL01326:Cr2 APN 1 194,823,529 (GRCm39) missense probably null 1.00
IGL01358:Cr2 APN 1 194,842,128 (GRCm39) missense probably damaging 1.00
IGL01410:Cr2 APN 1 194,845,542 (GRCm39) missense possibly damaging 0.49
IGL01468:Cr2 APN 1 194,850,843 (GRCm39) missense probably damaging 1.00
IGL01608:Cr2 APN 1 194,837,528 (GRCm39) missense possibly damaging 0.50
IGL01810:Cr2 APN 1 194,841,903 (GRCm39) missense possibly damaging 0.49
IGL01843:Cr2 APN 1 194,833,222 (GRCm39) splice site probably benign
IGL02332:Cr2 APN 1 194,842,630 (GRCm39) missense probably benign 0.19
IGL02934:Cr2 APN 1 194,836,633 (GRCm39) splice site probably benign
IGL02938:Cr2 APN 1 194,848,696 (GRCm39) missense probably damaging 1.00
IGL03149:Cr2 APN 1 194,848,674 (GRCm39) missense probably damaging 1.00
IGL03327:Cr2 APN 1 194,852,067 (GRCm39) missense probably damaging 1.00
IGL03346:Cr2 APN 1 194,852,067 (GRCm39) missense probably damaging 1.00
Pillar UTSW 1 194,838,196 (GRCm39) nonsense probably null
PIT4354001:Cr2 UTSW 1 194,848,617 (GRCm39) missense probably damaging 1.00
PIT4418001:Cr2 UTSW 1 194,839,760 (GRCm39) missense probably benign 0.08
R0128:Cr2 UTSW 1 194,848,539 (GRCm39) missense probably damaging 0.99
R0130:Cr2 UTSW 1 194,848,539 (GRCm39) missense probably damaging 0.99
R0380:Cr2 UTSW 1 194,839,715 (GRCm39) missense probably damaging 1.00
R0538:Cr2 UTSW 1 194,842,667 (GRCm39) splice site probably benign
R0605:Cr2 UTSW 1 194,845,904 (GRCm39) splice site probably benign
R0626:Cr2 UTSW 1 194,853,419 (GRCm39) missense possibly damaging 0.95
R1135:Cr2 UTSW 1 194,839,498 (GRCm39) missense probably damaging 1.00
R1396:Cr2 UTSW 1 194,851,561 (GRCm39) splice site probably null
R1422:Cr2 UTSW 1 194,853,433 (GRCm39) missense probably benign 0.01
R1467:Cr2 UTSW 1 194,839,817 (GRCm39) missense probably damaging 1.00
R1467:Cr2 UTSW 1 194,839,817 (GRCm39) missense probably damaging 1.00
R1511:Cr2 UTSW 1 194,837,580 (GRCm39) missense possibly damaging 0.92
R1572:Cr2 UTSW 1 194,845,622 (GRCm39) missense probably damaging 1.00
R1748:Cr2 UTSW 1 194,838,213 (GRCm39) nonsense probably null
R1761:Cr2 UTSW 1 194,837,431 (GRCm39) critical splice donor site probably null
R1824:Cr2 UTSW 1 194,839,624 (GRCm39) missense probably damaging 1.00
R1893:Cr2 UTSW 1 194,837,495 (GRCm39) missense probably benign 0.03
R1990:Cr2 UTSW 1 194,836,458 (GRCm39) missense possibly damaging 0.63
R1991:Cr2 UTSW 1 194,836,458 (GRCm39) missense possibly damaging 0.63
R1992:Cr2 UTSW 1 194,836,458 (GRCm39) missense possibly damaging 0.63
R2191:Cr2 UTSW 1 194,845,689 (GRCm39) missense possibly damaging 0.94
R2276:Cr2 UTSW 1 194,839,676 (GRCm39) missense possibly damaging 0.94
R2277:Cr2 UTSW 1 194,839,676 (GRCm39) missense possibly damaging 0.94
R3548:Cr2 UTSW 1 194,838,196 (GRCm39) nonsense probably null
R3743:Cr2 UTSW 1 194,832,274 (GRCm39) splice site probably benign
R3941:Cr2 UTSW 1 194,848,122 (GRCm39) missense probably damaging 0.97
R3963:Cr2 UTSW 1 194,842,047 (GRCm39) missense probably damaging 1.00
R4211:Cr2 UTSW 1 194,838,636 (GRCm39) missense probably damaging 0.96
R4484:Cr2 UTSW 1 194,836,482 (GRCm39) missense probably damaging 1.00
R4546:Cr2 UTSW 1 194,853,349 (GRCm39) missense possibly damaging 0.94
R4791:Cr2 UTSW 1 194,838,243 (GRCm39) missense probably damaging 1.00
R4801:Cr2 UTSW 1 194,845,619 (GRCm39) missense probably damaging 1.00
R4802:Cr2 UTSW 1 194,845,619 (GRCm39) missense probably damaging 1.00
R4874:Cr2 UTSW 1 194,858,878 (GRCm39) missense possibly damaging 0.82
R4885:Cr2 UTSW 1 194,841,039 (GRCm39) missense possibly damaging 0.92
R4889:Cr2 UTSW 1 194,858,893 (GRCm39) missense possibly damaging 0.70
R5154:Cr2 UTSW 1 194,841,754 (GRCm39) missense probably damaging 1.00
R5574:Cr2 UTSW 1 194,823,544 (GRCm39) missense probably damaging 1.00
R5594:Cr2 UTSW 1 194,839,498 (GRCm39) missense probably damaging 1.00
R5645:Cr2 UTSW 1 194,836,581 (GRCm39) missense probably damaging 1.00
R5700:Cr2 UTSW 1 194,842,065 (GRCm39) missense probably damaging 0.96
R5929:Cr2 UTSW 1 194,853,419 (GRCm39) missense possibly damaging 0.91
R6237:Cr2 UTSW 1 194,839,810 (GRCm39) missense probably damaging 1.00
R6299:Cr2 UTSW 1 194,850,954 (GRCm39) missense probably damaging 1.00
R6368:Cr2 UTSW 1 194,850,780 (GRCm39) missense probably damaging 1.00
R6406:Cr2 UTSW 1 194,852,079 (GRCm39) missense probably damaging 1.00
R6618:Cr2 UTSW 1 194,839,687 (GRCm39) missense probably damaging 0.98
R6684:Cr2 UTSW 1 194,853,329 (GRCm39) nonsense probably null
R6720:Cr2 UTSW 1 194,837,508 (GRCm39) missense probably damaging 0.97
R6866:Cr2 UTSW 1 194,833,999 (GRCm39) missense probably damaging 1.00
R6915:Cr2 UTSW 1 194,853,454 (GRCm39) missense probably benign 0.06
R7057:Cr2 UTSW 1 194,833,918 (GRCm39) missense possibly damaging 0.83
R7117:Cr2 UTSW 1 194,842,909 (GRCm39) missense possibly damaging 0.79
R7200:Cr2 UTSW 1 194,845,557 (GRCm39) missense probably damaging 1.00
R7209:Cr2 UTSW 1 194,851,032 (GRCm39) missense probably damaging 1.00
R7350:Cr2 UTSW 1 194,837,594 (GRCm39) missense probably benign 0.21
R7414:Cr2 UTSW 1 194,832,344 (GRCm39) missense probably benign
R7453:Cr2 UTSW 1 194,847,565 (GRCm39) splice site probably null
R7479:Cr2 UTSW 1 194,840,718 (GRCm39) critical splice donor site probably null
R7480:Cr2 UTSW 1 194,836,484 (GRCm39) missense probably damaging 1.00
R7570:Cr2 UTSW 1 194,851,648 (GRCm39) nonsense probably null
R7666:Cr2 UTSW 1 194,836,533 (GRCm39) missense probably damaging 1.00
R7921:Cr2 UTSW 1 194,833,975 (GRCm39) missense possibly damaging 0.94
R7923:Cr2 UTSW 1 194,850,995 (GRCm39) missense probably benign 0.03
R8396:Cr2 UTSW 1 194,840,376 (GRCm39) missense probably damaging 1.00
R8503:Cr2 UTSW 1 194,845,850 (GRCm39) missense probably benign
R8517:Cr2 UTSW 1 194,838,207 (GRCm39) missense probably benign 0.03
R8773:Cr2 UTSW 1 194,840,913 (GRCm39) missense probably damaging 1.00
R8849:Cr2 UTSW 1 194,839,547 (GRCm39) missense probably damaging 1.00
R8896:Cr2 UTSW 1 194,851,581 (GRCm39) missense possibly damaging 0.58
R8938:Cr2 UTSW 1 194,853,424 (GRCm39) missense probably damaging 0.99
R9027:Cr2 UTSW 1 194,834,029 (GRCm39) missense probably benign 0.08
R9045:Cr2 UTSW 1 194,837,680 (GRCm39) missense possibly damaging 0.61
R9116:Cr2 UTSW 1 194,840,977 (GRCm39) nonsense probably null
R9137:Cr2 UTSW 1 194,850,640 (GRCm39) critical splice donor site probably null
R9476:Cr2 UTSW 1 194,840,416 (GRCm39) missense probably damaging 0.97
R9497:Cr2 UTSW 1 194,850,743 (GRCm39) missense probably damaging 0.99
R9510:Cr2 UTSW 1 194,840,416 (GRCm39) missense probably damaging 0.97
R9752:Cr2 UTSW 1 194,823,575 (GRCm39) missense probably benign 0.37
R9799:Cr2 UTSW 1 194,842,988 (GRCm39) missense probably benign 0.02
X0028:Cr2 UTSW 1 194,832,290 (GRCm39) missense probably benign 0.09
X0066:Cr2 UTSW 1 194,848,629 (GRCm39) missense probably damaging 0.99
Z1176:Cr2 UTSW 1 194,836,461 (GRCm39) missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TGATGTGATGTGCCCCATACTCAAC -3'
(R):5'- CTATTGCCTTCTGCAATTCAGTGAAGC -3'

Sequencing Primer
(F):5'- TGATGTGCCCCATACTCAACTATAC -3'
(R):5'- CAGTGAAGCTTTGCTTACGAT -3'
Posted On 2014-05-14