Mutagenetix > Incidental Mutation

Incidental Mutation 'R1714:Abcb11'

190833

Institutional Source

Beutler Lab

Gene Symbol

Abcb11

Ensembl Gene

ENSMUSG00000027048

Gene Name

ATP-binding cassette, sub-family B (MDR/TAP), member 11

Synonyms

PFIC2, Bsep, PGY4, Lith1, ABC16, sister of P-glycoprotein

MMRRC Submission

039747-MU

Accession Numbers

Genbank: NM_021022; MGI: 1351619

Essential gene?

Possibly essential (E-score: 0.602) question?

Stock #

R1714 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

69238282-69342616 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 69306581 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Valine at position 179 (F179V)

Ref Sequence

ENSEMBL: ENSMUSP00000137017 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102709] [ENSMUST00000102710] [ENSMUST00000180142]

AlphaFold

Q9QY30

Predicted Effect

probably damaging
Transcript: ENSMUST00000102709
AA Change: F179V

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000099770
Gene: ENSMUSG00000027048
AA Change: F179V

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	62	373	1.3e-65	PFAM
AAA	447	639	1.65e-17	SMART
Pfam:ABC_membrane	755	1031	2.7e-55	PFAM
AAA	1105	1299	1.9e-17	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000102710
AA Change: F179V

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000099771
Gene: ENSMUSG00000027048
AA Change: F179V

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	62	371	1.7e-72	PFAM
AAA	447	639	1.65e-17	SMART
Pfam:ABC_membrane	755	1029	3.2e-59	PFAM
AAA	1105	1299	1.9e-17	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000180142
AA Change: F179V

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000137017
Gene: ENSMUSG00000027048
AA Change: F179V

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	62	371	1.4e-72	PFAM
AAA	447	639	1.65e-17	SMART
Pfam:ABC_membrane	755	1029	2.5e-59	PFAM
AAA	1105	1299	1.9e-17	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.5%

Validation Efficiency

MGI Phenotype

FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. The protein encoded by this gene is the major canalicular bile salt transporter in humans and mice. Mutations in the human gene cause a form of progressive familial intrahepatic cholestases which are a group of inherited disorders with severe cholestatic liver disease from early infancy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display intrahepatic cholestasis. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	C	T	13: 77,316,360	T892I	possibly damaging	Het
Adgrg6	G	T	10: 14,439,770	Q597K	possibly damaging	Het
Ankmy1	G	T	1: 92,885,194	Y464*	probably null	Het
Apba1	G	A	19: 23,944,952	E795K	possibly damaging	Het
Aqp12	T	A	1: 93,006,959	V186D	possibly damaging	Het
Brd8	A	T	18: 34,609,833	S253R	probably damaging	Het
Cdc42se2	A	T	11: 54,740,286	S2R	possibly damaging	Het
Chd9	A	C	8: 91,034,225		probably benign	Het
Clk4	C	T	11: 51,280,418	H219Y	probably damaging	Het
Cngb1	A	G	8: 95,257,931	Y417H	probably damaging	Het
Cr2	A	T	1: 195,151,686	F932I	possibly damaging	Het
Cxxc1	C	A	18: 74,219,863	R415S	probably damaging	Het
Dclk2	G	A	3: 86,906,093	A182V	probably benign	Het
Ddx11	T	G	17: 66,148,759	W718G	probably damaging	Het
Dmd	A	C	X: 83,964,750	T2069P	probably benign	Het
Dnaic1	T	C	4: 41,632,164	F533L	probably benign	Het
Dnajc5b	A	T	3: 19,579,101	R163*	probably null	Het
Dynll2	T	A	11: 87,984,012		probably null	Het
Ercc5	A	G	1: 44,167,339	T471A	probably benign	Het
Fan1	T	C	7: 64,366,687	D563G	probably benign	Het
Fbxo34	A	G	14: 47,529,201	Y6C	probably damaging	Het
Fcrl5	T	A	3: 87,446,406	S353T	probably damaging	Het
Gabrb3	A	T	7: 57,765,428	Y82F	probably damaging	Het
Gm20939	C	A	17: 94,875,806	P157T	probably damaging	Het
Haus3	A	T	5: 34,163,697	H468Q	probably benign	Het
Hist1h2ba	T	C	13: 23,933,952	T69A	probably benign	Het
Il20ra	T	C	10: 19,755,828	V259A	probably damaging	Het
Isg15	A	T	4: 156,199,957	V38E	probably damaging	Het
Kcnq3	A	G	15: 66,000,063	S586P	probably benign	Het
Kl	A	T	5: 150,953,333	Y206F	probably benign	Het
Klk1b24	C	A	7: 44,191,515	D122E	probably damaging	Het
Kmt2d	A	C	15: 98,862,950	S840A	unknown	Het
Krt34	A	G	11: 100,040,127	S150P	possibly damaging	Het
Lamc3	A	G	2: 31,940,757	K1502R	probably benign	Het
Letm1	G	T	5: 33,760,884	R306S	possibly damaging	Het
Lnx1	C	T	5: 74,607,737	G397S	probably null	Het
Lrrc8c	A	G	5: 105,607,291	T311A	possibly damaging	Het
Mpeg1	A	T	19: 12,462,834	D552V	probably damaging	Het
Myh11	C	T	16: 14,236,368		probably null	Het
Ndufa9	T	C	6: 126,822,191		probably null	Het
Olfr1289	A	T	2: 111,483,663	I78F	probably damaging	Het
Olfr1507	A	C	14: 52,490,414		probably null	Het
Olfr281	G	A	15: 98,456,733	C141Y	probably damaging	Het
Polr3d	A	C	14: 70,441,315	M117R	possibly damaging	Het
Ppp5c	T	C	7: 17,008,703	I237V	probably benign	Het
Prrc2c	G	A	1: 162,677,376	T2632M	probably damaging	Het
Ptprg	C	A	14: 12,213,697	Q1022K	probably damaging	Het
Pus10	T	A	11: 23,725,542	H471Q	probably damaging	Het
Ralgapa1	A	G	12: 55,642,389	V1928A	probably damaging	Het
Rbpms2	CACT	CACTACT	9: 65,651,665		probably benign	Het
Rbpms2	ACTGCTGCTGCTGCTGC	ACTGCTGCTGCTGCTGCTGC	9: 65,651,666		probably benign	Het
Rfpl4	T	G	7: 5,110,358	T269P	probably benign	Het
Rgs10	A	G	7: 128,403,222	V72A	probably damaging	Het
Rsph1	T	C	17: 31,255,216	N289S	probably benign	Het
Sbk2	T	C	7: 4,963,122	D21G	probably benign	Het
Shbg	A	T	11: 69,617,157	D127E	possibly damaging	Het
Spag16	A	G	1: 69,843,005	E52G	probably damaging	Het
Ssh2	G	A	11: 77,454,024	G945D	possibly damaging	Het
Sstr3	A	T	15: 78,540,273	D91E	probably damaging	Het
Syne2	C	A	12: 76,054,939	A669E	probably benign	Het
Traf3	A	G	12: 111,242,473	I109V	probably benign	Het
Ube2j1	A	G	4: 33,049,886	T295A	probably damaging	Het
Usp46	A	G	5: 74,003,167	V276A	probably benign	Het
Vmn1r200	T	C	13: 22,395,470	S139P	possibly damaging	Het
Ydjc	G	A	16: 17,147,799	V143M	probably damaging	Het
Zfp169	T	C	13: 48,498,854	E29G	probably benign	Het
Zfp292	A	G	4: 34,808,935	S1370P	probably damaging	Het
Zfp763	C	T	17: 33,019,617	D185N	probably damaging	Het
Zfp827	A	T	8: 79,060,573	N123Y	probably damaging	Het
Zfp979	A	T	4: 147,613,985	I89N	probably damaging	Het
Zfr2	T	C	10: 81,244,749	L419P	probably damaging	Het

Other mutations in Abcb11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00544:Abcb11	APN	2	69284681	missense	possibly damaging	0.90
IGL01407:Abcb11	APN	2	69245944	missense	probably damaging	1.00
IGL01583:Abcb11	APN	2	69296409	missense	possibly damaging	0.81
IGL01813:Abcb11	APN	2	69287592	splice site	probably benign
IGL01885:Abcb11	APN	2	69287627	missense	probably damaging	1.00
IGL01937:Abcb11	APN	2	69287612	missense	probably damaging	1.00
IGL02058:Abcb11	APN	2	69243498	missense	probably damaging	0.98
IGL02117:Abcb11	APN	2	69323825	splice site	probably benign
IGL02119:Abcb11	APN	2	69328000	critical splice acceptor site	probably null
IGL02120:Abcb11	APN	2	69257310	missense	probably damaging	1.00
IGL02158:Abcb11	APN	2	69299925	missense	probably damaging	0.96
IGL02212:Abcb11	APN	2	69248889	missense	probably damaging	0.97
IGL02306:Abcb11	APN	2	69265457	nonsense	probably null
IGL02505:Abcb11	APN	2	69245761	missense	probably damaging	1.00
IGL02538:Abcb11	APN	2	69306605	missense	possibly damaging	0.67
IGL02793:Abcb11	APN	2	69291949	missense	possibly damaging	0.90
IGL02863:Abcb11	APN	2	69284682	missense	probably damaging	0.99
IGL02875:Abcb11	APN	2	69291949	missense	possibly damaging	0.90
IGL03164:Abcb11	APN	2	69291999	nonsense	probably null
IGL03181:Abcb11	APN	2	69328008	intron	probably benign
3-1:Abcb11	UTSW	2	69327993	missense	probably benign	0.00
FR4737:Abcb11	UTSW	2	69243518	missense	probably damaging	0.97
R0031:Abcb11	UTSW	2	69285308	missense	probably damaging	1.00
R0398:Abcb11	UTSW	2	69286666	missense	probably null	0.82
R0413:Abcb11	UTSW	2	69328011	intron	probably benign
R0437:Abcb11	UTSW	2	69257295	missense	probably damaging	1.00
R0496:Abcb11	UTSW	2	69277884	splice site	probably benign
R0646:Abcb11	UTSW	2	69285283	missense	probably damaging	1.00
R0669:Abcb11	UTSW	2	69329318	missense	probably benign	0.15
R0856:Abcb11	UTSW	2	69323918	missense	probably benign
R1061:Abcb11	UTSW	2	69277809	missense	probably benign	0.00
R1460:Abcb11	UTSW	2	69257374	splice site	probably benign
R1739:Abcb11	UTSW	2	69261566	missense	probably damaging	1.00
R1856:Abcb11	UTSW	2	69245923	missense	probably damaging	1.00
R1994:Abcb11	UTSW	2	69282670	splice site	probably null
R2086:Abcb11	UTSW	2	69259476	splice site	probably benign
R2133:Abcb11	UTSW	2	69323883	missense	possibly damaging	0.65
R2516:Abcb11	UTSW	2	69329329	missense	possibly damaging	0.88
R2930:Abcb11	UTSW	2	69257358	missense	probably damaging	0.96
R3771:Abcb11	UTSW	2	69329376	splice site	probably benign
R3772:Abcb11	UTSW	2	69329376	splice site	probably benign
R3979:Abcb11	UTSW	2	69323976	missense	probably benign	0.11
R4227:Abcb11	UTSW	2	69284776	missense	probably damaging	1.00
R4255:Abcb11	UTSW	2	69306605	missense	probably benign	0.03
R4614:Abcb11	UTSW	2	69284681	missense	possibly damaging	0.90
R4647:Abcb11	UTSW	2	69285271	missense	probably damaging	1.00
R4719:Abcb11	UTSW	2	69259627	missense	probably damaging	1.00
R4734:Abcb11	UTSW	2	69323962	missense	possibly damaging	0.73
R4765:Abcb11	UTSW	2	69245867	missense	probably damaging	1.00
R4861:Abcb11	UTSW	2	69245905	missense	probably damaging	1.00
R4861:Abcb11	UTSW	2	69245905	missense	probably damaging	1.00
R4870:Abcb11	UTSW	2	69239196	missense	probably damaging	0.99
R4988:Abcb11	UTSW	2	69323892	missense	probably benign	0.12
R5028:Abcb11	UTSW	2	69274012	missense	probably damaging	1.00
R5048:Abcb11	UTSW	2	69308506	missense	probably benign	0.06
R5177:Abcb11	UTSW	2	69285295	missense	probably damaging	1.00
R5301:Abcb11	UTSW	2	69286847	missense	probably damaging	0.98
R5789:Abcb11	UTSW	2	69245764	missense	probably damaging	1.00
R5892:Abcb11	UTSW	2	69261500	missense	probably damaging	0.99
R6003:Abcb11	UTSW	2	69243467	missense	probably benign	0.43
R6252:Abcb11	UTSW	2	69291961	missense	probably benign	0.10
R6389:Abcb11	UTSW	2	69323894	missense	probably damaging	1.00
R6512:Abcb11	UTSW	2	69282652	missense	probably benign
R6590:Abcb11	UTSW	2	69284718	missense	probably damaging	1.00
R6690:Abcb11	UTSW	2	69284718	missense	probably damaging	1.00
R6732:Abcb11	UTSW	2	69286846	missense	probably damaging	1.00
R6870:Abcb11	UTSW	2	69285298	missense	possibly damaging	0.91
R7028:Abcb11	UTSW	2	69265675	missense	probably benign
R7223:Abcb11	UTSW	2	69274143	missense	probably benign
R7323:Abcb11	UTSW	2	69287635	missense	probably damaging	1.00
R7337:Abcb11	UTSW	2	69245769	missense	probably damaging	1.00
R7339:Abcb11	UTSW	2	69299867	missense	probably damaging	0.99
R7340:Abcb11	UTSW	2	69299867	missense	probably damaging	0.99
R7341:Abcb11	UTSW	2	69299867	missense	probably damaging	0.99
R7343:Abcb11	UTSW	2	69299867	missense	probably damaging	0.99
R7366:Abcb11	UTSW	2	69299867	missense	probably damaging	0.99
R7393:Abcb11	UTSW	2	69299867	missense	probably damaging	0.99
R7394:Abcb11	UTSW	2	69299867	missense	probably damaging	0.99
R7405:Abcb11	UTSW	2	69287619	missense	probably damaging	1.00
R7411:Abcb11	UTSW	2	69303936	critical splice donor site	probably null
R7488:Abcb11	UTSW	2	69277802	missense	probably benign
R7544:Abcb11	UTSW	2	69265486	missense	probably benign	0.05
R7660:Abcb11	UTSW	2	69287594	splice site	probably null
R7754:Abcb11	UTSW	2	69286818	missense	probably damaging	1.00
R7771:Abcb11	UTSW	2	69239191	missense	probably damaging	0.99
R7794:Abcb11	UTSW	2	69286678	missense	possibly damaging	0.62
R7834:Abcb11	UTSW	2	69284724	missense	probably damaging	1.00
R7897:Abcb11	UTSW	2	69323872	frame shift	probably null
R7897:Abcb11	UTSW	2	69323873	small deletion	probably benign
R7937:Abcb11	UTSW	2	69323873	small deletion	probably benign
R8004:Abcb11	UTSW	2	69257210	missense	possibly damaging	0.68
R8089:Abcb11	UTSW	2	69274039	missense	probably benign	0.09
R8279:Abcb11	UTSW	2	69239205	missense	probably benign	0.05
R8426:Abcb11	UTSW	2	69325262	missense	probably benign
R8441:Abcb11	UTSW	2	69257230	missense	possibly damaging	0.93
R8460:Abcb11	UTSW	2	69324037	missense	possibly damaging	0.70
R8462:Abcb11	UTSW	2	69274155	missense	probably benign
R8532:Abcb11	UTSW	2	69259691	missense	possibly damaging	0.69
R8534:Abcb11	UTSW	2	69323846	missense	possibly damaging	0.89
R8711:Abcb11	UTSW	2	69265512	missense	probably damaging	1.00
R8746:Abcb11	UTSW	2	69257410	intron	probably benign
R8964:Abcb11	UTSW	2	69286717	missense	possibly damaging	0.52
R8990:Abcb11	UTSW	2	69274150	missense
R9081:Abcb11	UTSW	2	69292044	missense	possibly damaging	0.59
R9093:Abcb11	UTSW	2	69239169	missense	probably damaging	0.97
R9228:Abcb11	UTSW	2	69308465	nonsense	probably null
R9294:Abcb11	UTSW	2	69265496	missense	possibly damaging	0.89
X0058:Abcb11	UTSW	2	69289443	missense	probably benign	0.12
X0062:Abcb11	UTSW	2	69245906	missense	probably damaging	1.00
X0065:Abcb11	UTSW	2	69299866	missense	probably damaging	0.99
Z1176:Abcb11	UTSW	2	69291981	missense	probably damaging	1.00
Z1177:Abcb11	UTSW	2	69306529	missense	probably damaging	1.00
Z1177:Abcb11	UTSW	2	69329269	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- CCGTCTCTCAGTTTCACTGTATGTCAAA -3'
(R):5'- ACCATAACCACGGGAAGTGCGA -3'

Sequencing Primer
(F):5'- cctccacctcccacctac -3'
(R):5'- CACGGGAAGTGCGATTTTTCAG -3'

Posted On

2014-05-14