Incidental Mutation 'R1714:Olfr1289'
Institutional Source Beutler Lab
Gene Symbol Olfr1289
Ensembl Gene ENSMUSG00000061195
Gene Nameolfactory receptor 1289
SynonymsGA_x6K02T2Q125-72534883-72535821, MOR245-6
MMRRC Submission 039747-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R1714 (G1)
Quality Score225
Status Not validated
Chromosomal Location111480819-111484615 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 111483663 bp
Amino Acid Change Isoleucine to Phenylalanine at position 78 (I78F)
Ref Sequence ENSEMBL: ENSMUSP00000147119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102551] [ENSMUST00000104889] [ENSMUST00000120021] [ENSMUST00000207494] [ENSMUST00000214816] [ENSMUST00000217611]
Predicted Effect probably damaging
Transcript: ENSMUST00000102551
AA Change: I78F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099611
Gene: ENSMUSG00000108908
AA Change: I78F

Pfam:7tm_4 17 289 6e-45 PFAM
Pfam:7TM_GPCR_Srsx 20 288 1.4e-7 PFAM
Pfam:7tm_1 27 273 7e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000104889
SMART Domains Protein: ENSMUSP00000100485
Gene: ENSMUSG00000044039

Pfam:7tm_4 31 304 1.3e-43 PFAM
Pfam:7tm_1 41 287 2.5e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120021
AA Change: I106F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000207494
AA Change: I78F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000214816
Predicted Effect probably benign
Transcript: ENSMUST00000217611
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225425
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C T 13: 77,316,360 T892I possibly damaging Het
Abcb11 A C 2: 69,306,581 F179V probably damaging Het
Adgrg6 G T 10: 14,439,770 Q597K possibly damaging Het
Ankmy1 G T 1: 92,885,194 Y464* probably null Het
Apba1 G A 19: 23,944,952 E795K possibly damaging Het
Aqp12 T A 1: 93,006,959 V186D possibly damaging Het
Brd8 A T 18: 34,609,833 S253R probably damaging Het
Cdc42se2 A T 11: 54,740,286 S2R possibly damaging Het
Chd9 A C 8: 91,034,225 probably benign Het
Clk4 C T 11: 51,280,418 H219Y probably damaging Het
Cngb1 A G 8: 95,257,931 Y417H probably damaging Het
Cr2 A T 1: 195,151,686 F932I possibly damaging Het
Cxxc1 C A 18: 74,219,863 R415S probably damaging Het
Dclk2 G A 3: 86,906,093 A182V probably benign Het
Ddx11 T G 17: 66,148,759 W718G probably damaging Het
Dmd A C X: 83,964,750 T2069P probably benign Het
Dnaic1 T C 4: 41,632,164 F533L probably benign Het
Dnajc5b A T 3: 19,579,101 R163* probably null Het
Dynll2 T A 11: 87,984,012 probably null Het
Ercc5 A G 1: 44,167,339 T471A probably benign Het
Fan1 T C 7: 64,366,687 D563G probably benign Het
Fbxo34 A G 14: 47,529,201 Y6C probably damaging Het
Fcrl5 T A 3: 87,446,406 S353T probably damaging Het
Gabrb3 A T 7: 57,765,428 Y82F probably damaging Het
Gm20939 C A 17: 94,875,806 P157T probably damaging Het
Haus3 A T 5: 34,163,697 H468Q probably benign Het
Hist1h2ba T C 13: 23,933,952 T69A probably benign Het
Il20ra T C 10: 19,755,828 V259A probably damaging Het
Isg15 A T 4: 156,199,957 V38E probably damaging Het
Kcnq3 A G 15: 66,000,063 S586P probably benign Het
Kl A T 5: 150,953,333 Y206F probably benign Het
Klk1b24 C A 7: 44,191,515 D122E probably damaging Het
Kmt2d A C 15: 98,862,950 S840A unknown Het
Krt34 A G 11: 100,040,127 S150P possibly damaging Het
Lamc3 A G 2: 31,940,757 K1502R probably benign Het
Letm1 G T 5: 33,760,884 R306S possibly damaging Het
Lnx1 C T 5: 74,607,737 G397S probably null Het
Lrrc8c A G 5: 105,607,291 T311A possibly damaging Het
Mpeg1 A T 19: 12,462,834 D552V probably damaging Het
Myh11 C T 16: 14,236,368 probably null Het
Ndufa9 T C 6: 126,822,191 probably null Het
Olfr1507 A C 14: 52,490,414 probably null Het
Olfr281 G A 15: 98,456,733 C141Y probably damaging Het
Polr3d A C 14: 70,441,315 M117R possibly damaging Het
Ppp5c T C 7: 17,008,703 I237V probably benign Het
Prrc2c G A 1: 162,677,376 T2632M probably damaging Het
Ptprg C A 14: 12,213,697 Q1022K probably damaging Het
Pus10 T A 11: 23,725,542 H471Q probably damaging Het
Ralgapa1 A G 12: 55,642,389 V1928A probably damaging Het
Rbpms2 CACT CACTACT 9: 65,651,665 probably benign Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Rfpl4 T G 7: 5,110,358 T269P probably benign Het
Rgs10 A G 7: 128,403,222 V72A probably damaging Het
Rsph1 T C 17: 31,255,216 N289S probably benign Het
Sbk2 T C 7: 4,963,122 D21G probably benign Het
Shbg A T 11: 69,617,157 D127E possibly damaging Het
Spag16 A G 1: 69,843,005 E52G probably damaging Het
Ssh2 G A 11: 77,454,024 G945D possibly damaging Het
Sstr3 A T 15: 78,540,273 D91E probably damaging Het
Syne2 C A 12: 76,054,939 A669E probably benign Het
Traf3 A G 12: 111,242,473 I109V probably benign Het
Ube2j1 A G 4: 33,049,886 T295A probably damaging Het
Usp46 A G 5: 74,003,167 V276A probably benign Het
Vmn1r200 T C 13: 22,395,470 S139P possibly damaging Het
Ydjc G A 16: 17,147,799 V143M probably damaging Het
Zfp169 T C 13: 48,498,854 E29G probably benign Het
Zfp292 A G 4: 34,808,935 S1370P probably damaging Het
Zfp763 C T 17: 33,019,617 D185N probably damaging Het
Zfp827 A T 8: 79,060,573 N123Y probably damaging Het
Zfp979 A T 4: 147,613,985 I89N probably damaging Het
Zfr2 T C 10: 81,244,749 L419P probably damaging Het
Other mutations in Olfr1289
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Olfr1289 APN 2 111484101 missense probably damaging 1.00
IGL01682:Olfr1289 APN 2 111483843 missense probably damaging 1.00
IGL02028:Olfr1289 APN 2 111483471 missense probably benign 0.01
IGL02731:Olfr1289 APN 2 111483528 missense probably benign 0.00
IGL03035:Olfr1289 APN 2 111483823 missense probably benign 0.04
R1214:Olfr1289 UTSW 2 111483892 missense probably damaging 1.00
R1471:Olfr1289 UTSW 2 111484006 missense probably damaging 1.00
R2088:Olfr1289 UTSW 2 111484278 missense probably damaging 1.00
R2136:Olfr1289 UTSW 2 111483616 missense probably damaging 1.00
R2141:Olfr1289 UTSW 2 111483630 missense probably benign 0.23
R3945:Olfr1289 UTSW 2 111483687 nonsense probably null
R4276:Olfr1289 UTSW 2 111483504 missense probably damaging 1.00
R4562:Olfr1289 UTSW 2 111483564 missense probably benign 0.00
R4896:Olfr1289 UTSW 2 111483660 missense possibly damaging 0.82
R4946:Olfr1289 UTSW 2 111483966 missense possibly damaging 0.93
R5004:Olfr1289 UTSW 2 111483660 missense possibly damaging 0.82
R5686:Olfr1289 UTSW 2 111484143 missense probably damaging 1.00
R6032:Olfr1289 UTSW 2 111483850 missense probably damaging 1.00
R6032:Olfr1289 UTSW 2 111483850 missense probably damaging 1.00
R6960:Olfr1289 UTSW 2 111483726 missense possibly damaging 0.70
R7293:Olfr1289 UTSW 2 111483354 splice site probably null
R7642:Olfr1289 UTSW 2 111483478 missense probably damaging 0.96
R8429:Olfr1289 UTSW 2 111483495 missense possibly damaging 0.55
R8447:Olfr1289 UTSW 2 111483756 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-05-14