Incidental Mutation 'R1714:Dnaic1'
ID190841
Institutional Source Beutler Lab
Gene Symbol Dnaic1
Ensembl Gene ENSMUSG00000061322
Gene Namedynein, axonemal, intermediate chain 1
Synonyms
MMRRC Submission 039747-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.357) question?
Stock #R1714 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location41569775-41638158 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 41632164 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 533 (F533L)
Ref Sequence ENSEMBL: ENSMUSP00000100028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102963] [ENSMUST00000119127]
Predicted Effect probably benign
Transcript: ENSMUST00000102963
AA Change: F533L

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000100028
Gene: ENSMUSG00000061322
AA Change: F533L

DomainStartEndE-ValueType
low complexity region 134 158 N/A INTRINSIC
low complexity region 238 261 N/A INTRINSIC
Blast:WD40 319 370 1e-17 BLAST
WD40 374 413 1.5e-3 SMART
WD40 419 465 4.4e-2 SMART
Blast:WD40 493 526 5e-13 BLAST
WD40 530 570 9.3e-9 SMART
WD40 575 612 6e-3 SMART
WD40 623 659 1.4e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119127
SMART Domains Protein: ENSMUSP00000113929
Gene: ENSMUSG00000061322

DomainStartEndE-ValueType
Blast:WD40 16 53 2e-19 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143198
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dynein intermediate chain family. The encoded protein is part of the dynein complex in respiratory cilia. The inner- and outer-arm dyneins, which bridge between the doublet microtubules in axonemes, are the force-generating proteins responsible for the sliding movement in axonemes. The intermediate and light chains, thought to form the base of the dynein arm, help mediate attachment and may also participate in regulating dynein activity. Mutations in this gene result in abnormal ciliary ultrastructure and function associated with primary ciliary dyskinesia and Kartagener syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mutant mice exhibit situs inversus, heterotaxia and ciliary dyskinesia including cardiovascular defects and decreased ciliary activity in the trachea, reduced to absent mucociliary clearance, and chronic rhinosinusitis. Hydrocephaly is also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C T 13: 77,316,360 T892I possibly damaging Het
Abcb11 A C 2: 69,306,581 F179V probably damaging Het
Adgrg6 G T 10: 14,439,770 Q597K possibly damaging Het
Ankmy1 G T 1: 92,885,194 Y464* probably null Het
Apba1 G A 19: 23,944,952 E795K possibly damaging Het
Aqp12 T A 1: 93,006,959 V186D possibly damaging Het
Brd8 A T 18: 34,609,833 S253R probably damaging Het
Cdc42se2 A T 11: 54,740,286 S2R possibly damaging Het
Chd9 A C 8: 91,034,225 probably benign Het
Clk4 C T 11: 51,280,418 H219Y probably damaging Het
Cngb1 A G 8: 95,257,931 Y417H probably damaging Het
Cr2 A T 1: 195,151,686 F932I possibly damaging Het
Cxxc1 C A 18: 74,219,863 R415S probably damaging Het
Dclk2 G A 3: 86,906,093 A182V probably benign Het
Ddx11 T G 17: 66,148,759 W718G probably damaging Het
Dmd A C X: 83,964,750 T2069P probably benign Het
Dnajc5b A T 3: 19,579,101 R163* probably null Het
Dynll2 T A 11: 87,984,012 probably null Het
Ercc5 A G 1: 44,167,339 T471A probably benign Het
Fan1 T C 7: 64,366,687 D563G probably benign Het
Fbxo34 A G 14: 47,529,201 Y6C probably damaging Het
Fcrl5 T A 3: 87,446,406 S353T probably damaging Het
Gabrb3 A T 7: 57,765,428 Y82F probably damaging Het
Gm20939 C A 17: 94,875,806 P157T probably damaging Het
Haus3 A T 5: 34,163,697 H468Q probably benign Het
Hist1h2ba T C 13: 23,933,952 T69A probably benign Het
Il20ra T C 10: 19,755,828 V259A probably damaging Het
Isg15 A T 4: 156,199,957 V38E probably damaging Het
Kcnq3 A G 15: 66,000,063 S586P probably benign Het
Kl A T 5: 150,953,333 Y206F probably benign Het
Klk1b24 C A 7: 44,191,515 D122E probably damaging Het
Kmt2d A C 15: 98,862,950 S840A unknown Het
Krt34 A G 11: 100,040,127 S150P possibly damaging Het
Lamc3 A G 2: 31,940,757 K1502R probably benign Het
Letm1 G T 5: 33,760,884 R306S possibly damaging Het
Lnx1 C T 5: 74,607,737 G397S probably null Het
Lrrc8c A G 5: 105,607,291 T311A possibly damaging Het
Mpeg1 A T 19: 12,462,834 D552V probably damaging Het
Myh11 C T 16: 14,236,368 probably null Het
Ndufa9 T C 6: 126,822,191 probably null Het
Olfr1289 A T 2: 111,483,663 I78F probably damaging Het
Olfr1507 A C 14: 52,490,414 probably null Het
Olfr281 G A 15: 98,456,733 C141Y probably damaging Het
Polr3d A C 14: 70,441,315 M117R possibly damaging Het
Ppp5c T C 7: 17,008,703 I237V probably benign Het
Prrc2c G A 1: 162,677,376 T2632M probably damaging Het
Ptprg C A 14: 12,213,697 Q1022K probably damaging Het
Pus10 T A 11: 23,725,542 H471Q probably damaging Het
Ralgapa1 A G 12: 55,642,389 V1928A probably damaging Het
Rbpms2 CACT CACTACT 9: 65,651,665 probably benign Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Rfpl4 T G 7: 5,110,358 T269P probably benign Het
Rgs10 A G 7: 128,403,222 V72A probably damaging Het
Rsph1 T C 17: 31,255,216 N289S probably benign Het
Sbk2 T C 7: 4,963,122 D21G probably benign Het
Shbg A T 11: 69,617,157 D127E possibly damaging Het
Spag16 A G 1: 69,843,005 E52G probably damaging Het
Ssh2 G A 11: 77,454,024 G945D possibly damaging Het
Sstr3 A T 15: 78,540,273 D91E probably damaging Het
Syne2 C A 12: 76,054,939 A669E probably benign Het
Traf3 A G 12: 111,242,473 I109V probably benign Het
Ube2j1 A G 4: 33,049,886 T295A probably damaging Het
Usp46 A G 5: 74,003,167 V276A probably benign Het
Vmn1r200 T C 13: 22,395,470 S139P possibly damaging Het
Ydjc G A 16: 17,147,799 V143M probably damaging Het
Zfp169 T C 13: 48,498,854 E29G probably benign Het
Zfp292 A G 4: 34,808,935 S1370P probably damaging Het
Zfp763 C T 17: 33,019,617 D185N probably damaging Het
Zfp827 A T 8: 79,060,573 N123Y probably damaging Het
Zfp979 A T 4: 147,613,985 I89N probably damaging Het
Zfr2 T C 10: 81,244,749 L419P probably damaging Het
Other mutations in Dnaic1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02678:Dnaic1 APN 4 41602917 missense probably benign 0.03
IGL02825:Dnaic1 APN 4 41625101 splice site probably benign
IGL03072:Dnaic1 APN 4 41602979 missense probably benign 0.00
H8562:Dnaic1 UTSW 4 41629833 missense possibly damaging 0.81
R0114:Dnaic1 UTSW 4 41605686 splice site probably benign
R0138:Dnaic1 UTSW 4 41629814 missense possibly damaging 0.49
R0153:Dnaic1 UTSW 4 41635162 unclassified probably benign
R0465:Dnaic1 UTSW 4 41629988 unclassified probably null
R0550:Dnaic1 UTSW 4 41596274 nonsense probably null
R0555:Dnaic1 UTSW 4 41625335 missense possibly damaging 0.64
R0890:Dnaic1 UTSW 4 41604253 missense possibly damaging 0.69
R0928:Dnaic1 UTSW 4 41602566 missense possibly damaging 0.57
R0944:Dnaic1 UTSW 4 41629997 missense probably benign
R1902:Dnaic1 UTSW 4 41625319 nonsense probably null
R1919:Dnaic1 UTSW 4 41570020 critical splice donor site probably null
R1983:Dnaic1 UTSW 4 41603232 missense probably benign
R2036:Dnaic1 UTSW 4 41632225 missense probably damaging 1.00
R2306:Dnaic1 UTSW 4 41625239 missense probably benign
R2925:Dnaic1 UTSW 4 41597919 missense probably damaging 1.00
R3404:Dnaic1 UTSW 4 41603246 missense probably benign 0.00
R3720:Dnaic1 UTSW 4 41602615 missense probably damaging 1.00
R3721:Dnaic1 UTSW 4 41602615 missense probably damaging 1.00
R3722:Dnaic1 UTSW 4 41602615 missense probably damaging 1.00
R3931:Dnaic1 UTSW 4 41604229 missense probably damaging 1.00
R4330:Dnaic1 UTSW 4 41637966 missense probably damaging 1.00
R4755:Dnaic1 UTSW 4 41610269 missense probably damaging 0.99
R4905:Dnaic1 UTSW 4 41614269 missense probably benign 0.05
R4997:Dnaic1 UTSW 4 41597919 missense possibly damaging 0.80
R5088:Dnaic1 UTSW 4 41597630 missense probably benign 0.00
R5088:Dnaic1 UTSW 4 41632251 missense probably benign 0.02
R5970:Dnaic1 UTSW 4 41625281 missense probably benign 0.14
R5987:Dnaic1 UTSW 4 41632391 missense probably benign 0.03
R6247:Dnaic1 UTSW 4 41605775 missense probably benign
R6727:Dnaic1 UTSW 4 41625308 missense probably benign
R6874:Dnaic1 UTSW 4 41632412 missense probably damaging 1.00
R6914:Dnaic1 UTSW 4 41625176 missense probably benign 0.01
R7508:Dnaic1 UTSW 4 41614323 missense probably benign 0.01
R7831:Dnaic1 UTSW 4 41614695 critical splice donor site probably null
R7832:Dnaic1 UTSW 4 41605823 missense probably benign 0.42
R7914:Dnaic1 UTSW 4 41614695 critical splice donor site probably null
R7915:Dnaic1 UTSW 4 41605823 missense probably benign 0.42
R8065:Dnaic1 UTSW 4 41614258 missense probably damaging 1.00
R8067:Dnaic1 UTSW 4 41614258 missense probably damaging 1.00
R8234:Dnaic1 UTSW 4 41625221 missense probably benign 0.00
X0065:Dnaic1 UTSW 4 41629868 missense possibly damaging 0.89
Z1176:Dnaic1 UTSW 4 41614323 missense probably benign 0.32
Z1177:Dnaic1 UTSW 4 41569809 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ACAAAGTAGGCTGTGCCGCATC -3'
(R):5'- TGACTGCTGCAAACACAGTGGAAG -3'

Sequencing Primer
(F):5'- GGAGAGAGAAGCCACTTTCTAACTC -3'
(R):5'- TCACAGTGTCAGAGCTGAGG -3'
Posted On2014-05-14