Incidental Mutation 'R1714:Letm1'
ID 190847
Institutional Source Beutler Lab
Gene Symbol Letm1
Ensembl Gene ENSMUSG00000005299
Gene Name leucine zipper-EF-hand containing transmembrane protein 1
Synonyms
MMRRC Submission 039747-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.961) question?
Stock # R1714 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 33897017-33940061 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 33918228 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 306 (R306S)
Ref Sequence ENSEMBL: ENSMUSP00000005431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005431]
AlphaFold Q9Z2I0
Predicted Effect possibly damaging
Transcript: ENSMUST00000005431
AA Change: R306S

PolyPhen 2 Score 0.513 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000005431
Gene: ENSMUSG00000005299
AA Change: R306S

DomainStartEndE-ValueType
low complexity region 10 30 N/A INTRINSIC
low complexity region 120 135 N/A INTRINSIC
Pfam:LETM1 152 417 1.2e-111 PFAM
coiled coil region 445 493 N/A INTRINSIC
low complexity region 503 513 N/A INTRINSIC
coiled coil region 537 598 N/A INTRINSIC
SCOP:d1c7va_ 647 691 4e-3 SMART
coiled coil region 708 738 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131139
Predicted Effect probably benign
Transcript: ENSMUST00000200827
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is localized to the inner mitochondrial membrane. The protein functions to maintain the mitochondrial tubular shapes and is required for normal mitochondrial morphology and cellular viability. Mutations in this gene cause Wolf-Hirschhorn syndrome, a complex malformation syndrome caused by the deletion of parts of the distal short arm of chromosome 4. Related pseudogenes have been identified on chromosomes 8, 15 and 19. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous deletion of this gene causes embryonic lethality prior to E6.5 while ~50% of heterozygotes die before E13.5. Surviving heterozygous mice show altered glucose metabolism, impaired control of brain ATP levels, and increased susceptibility to kainic acid-induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C T 13: 77,464,479 (GRCm39) T892I possibly damaging Het
Abcb11 A C 2: 69,136,925 (GRCm39) F179V probably damaging Het
Adgrg6 G T 10: 14,315,514 (GRCm39) Q597K possibly damaging Het
Ankmy1 G T 1: 92,812,916 (GRCm39) Y464* probably null Het
Apba1 G A 19: 23,922,316 (GRCm39) E795K possibly damaging Het
Aqp12 T A 1: 92,934,681 (GRCm39) V186D possibly damaging Het
Brd8 A T 18: 34,742,886 (GRCm39) S253R probably damaging Het
Cdc42se2 A T 11: 54,631,112 (GRCm39) S2R possibly damaging Het
Chd9 A C 8: 91,760,853 (GRCm39) probably benign Het
Clk4 C T 11: 51,171,245 (GRCm39) H219Y probably damaging Het
Cngb1 A G 8: 95,984,559 (GRCm39) Y417H probably damaging Het
Cr2 A T 1: 194,833,994 (GRCm39) F932I possibly damaging Het
Cxxc1 C A 18: 74,352,934 (GRCm39) R415S probably damaging Het
Dclk2 G A 3: 86,813,400 (GRCm39) A182V probably benign Het
Ddx11 T G 17: 66,455,754 (GRCm39) W718G probably damaging Het
Dmd A C X: 83,008,356 (GRCm39) T2069P probably benign Het
Dnai1 T C 4: 41,632,164 (GRCm39) F533L probably benign Het
Dnajc5b A T 3: 19,633,265 (GRCm39) R163* probably null Het
Dynll2 T A 11: 87,874,838 (GRCm39) probably null Het
Ercc5 A G 1: 44,206,499 (GRCm39) T471A probably benign Het
Fan1 T C 7: 64,016,435 (GRCm39) D563G probably benign Het
Fbxo34 A G 14: 47,766,658 (GRCm39) Y6C probably damaging Het
Fcrl5 T A 3: 87,353,713 (GRCm39) S353T probably damaging Het
Gabrb3 A T 7: 57,415,176 (GRCm39) Y82F probably damaging Het
Gm20939 C A 17: 95,183,234 (GRCm39) P157T probably damaging Het
H2bc1 T C 13: 24,117,935 (GRCm39) T69A probably benign Het
Haus3 A T 5: 34,321,041 (GRCm39) H468Q probably benign Het
Il20ra T C 10: 19,631,576 (GRCm39) V259A probably damaging Het
Isg15 A T 4: 156,284,414 (GRCm39) V38E probably damaging Het
Kcnq3 A G 15: 65,871,912 (GRCm39) S586P probably benign Het
Kl A T 5: 150,876,798 (GRCm39) Y206F probably benign Het
Klk1b24 C A 7: 43,840,939 (GRCm39) D122E probably damaging Het
Kmt2d A C 15: 98,760,831 (GRCm39) S840A unknown Het
Krt34 A G 11: 99,930,953 (GRCm39) S150P possibly damaging Het
Lamc3 A G 2: 31,830,769 (GRCm39) K1502R probably benign Het
Lnx1 C T 5: 74,768,398 (GRCm39) G397S probably null Het
Lrrc8c A G 5: 105,755,157 (GRCm39) T311A possibly damaging Het
Mpeg1 A T 19: 12,440,198 (GRCm39) D552V probably damaging Het
Myh11 C T 16: 14,054,232 (GRCm39) probably null Het
Ndufa9 T C 6: 126,799,154 (GRCm39) probably null Het
Or4e5 A C 14: 52,727,871 (GRCm39) probably null Het
Or4f4b A T 2: 111,314,008 (GRCm39) I78F probably damaging Het
Or8s8 G A 15: 98,354,614 (GRCm39) C141Y probably damaging Het
Polr3d A C 14: 70,678,755 (GRCm39) M117R possibly damaging Het
Ppp5c T C 7: 16,742,628 (GRCm39) I237V probably benign Het
Prrc2c G A 1: 162,504,945 (GRCm39) T2632M probably damaging Het
Ptprg C A 14: 12,213,697 (GRCm38) Q1022K probably damaging Het
Pus10 T A 11: 23,675,542 (GRCm39) H471Q probably damaging Het
Ralgapa1 A G 12: 55,689,174 (GRCm39) V1928A probably damaging Het
Rbpms2 CACT CACTACT 9: 65,558,947 (GRCm39) probably benign Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,558,948 (GRCm39) probably benign Het
Rfpl4 T G 7: 5,113,357 (GRCm39) T269P probably benign Het
Rgs10 A G 7: 128,004,946 (GRCm39) V72A probably damaging Het
Rsph1 T C 17: 31,474,190 (GRCm39) N289S probably benign Het
Sbk2 T C 7: 4,966,121 (GRCm39) D21G probably benign Het
Shbg A T 11: 69,507,983 (GRCm39) D127E possibly damaging Het
Spag16 A G 1: 69,882,164 (GRCm39) E52G probably damaging Het
Ssh2 G A 11: 77,344,850 (GRCm39) G945D possibly damaging Het
Sstr3 A T 15: 78,424,473 (GRCm39) D91E probably damaging Het
Syne2 C A 12: 76,101,713 (GRCm39) A669E probably benign Het
Traf3 A G 12: 111,208,907 (GRCm39) I109V probably benign Het
Ube2j1 A G 4: 33,049,886 (GRCm39) T295A probably damaging Het
Usp46 A G 5: 74,163,828 (GRCm39) V276A probably benign Het
Vmn1r200 T C 13: 22,579,640 (GRCm39) S139P possibly damaging Het
Ydjc G A 16: 16,965,663 (GRCm39) V143M probably damaging Het
Zfp169 T C 13: 48,652,330 (GRCm39) E29G probably benign Het
Zfp292 A G 4: 34,808,935 (GRCm39) S1370P probably damaging Het
Zfp763 C T 17: 33,238,591 (GRCm39) D185N probably damaging Het
Zfp827 A T 8: 79,787,202 (GRCm39) N123Y probably damaging Het
Zfp979 A T 4: 147,698,442 (GRCm39) I89N probably damaging Het
Zfr2 T C 10: 81,080,583 (GRCm39) L419P probably damaging Het
Other mutations in Letm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Letm1 APN 5 33,919,934 (GRCm39) missense possibly damaging 0.82
IGL01073:Letm1 APN 5 33,906,144 (GRCm39) missense possibly damaging 0.89
IGL01882:Letm1 APN 5 33,927,009 (GRCm39) missense probably benign 0.00
IGL02186:Letm1 APN 5 33,902,391 (GRCm39) missense probably benign 0.00
IGL02699:Letm1 APN 5 33,902,492 (GRCm39) missense possibly damaging 0.93
IGL03089:Letm1 APN 5 33,918,202 (GRCm39) missense probably damaging 1.00
R0466:Letm1 UTSW 5 33,919,074 (GRCm39) splice site probably benign
R0639:Letm1 UTSW 5 33,926,770 (GRCm39) missense possibly damaging 0.88
R1370:Letm1 UTSW 5 33,936,026 (GRCm39) splice site probably null
R1415:Letm1 UTSW 5 33,926,906 (GRCm39) missense probably benign 0.06
R1511:Letm1 UTSW 5 33,909,899 (GRCm39) missense probably damaging 1.00
R1771:Letm1 UTSW 5 33,926,811 (GRCm39) missense probably damaging 1.00
R1990:Letm1 UTSW 5 33,926,859 (GRCm39) frame shift probably null
R1991:Letm1 UTSW 5 33,926,859 (GRCm39) frame shift probably null
R2143:Letm1 UTSW 5 33,926,859 (GRCm39) frame shift probably null
R2145:Letm1 UTSW 5 33,926,859 (GRCm39) frame shift probably null
R2202:Letm1 UTSW 5 33,926,830 (GRCm39) missense possibly damaging 0.64
R2290:Letm1 UTSW 5 33,926,859 (GRCm39) frame shift probably null
R2292:Letm1 UTSW 5 33,926,859 (GRCm39) frame shift probably null
R5574:Letm1 UTSW 5 33,926,730 (GRCm39) missense possibly damaging 0.46
R6954:Letm1 UTSW 5 33,939,851 (GRCm39) missense probably benign 0.35
R7265:Letm1 UTSW 5 33,935,992 (GRCm39) missense possibly damaging 0.62
R8713:Letm1 UTSW 5 33,919,849 (GRCm39) missense probably damaging 1.00
R9028:Letm1 UTSW 5 33,909,847 (GRCm39) missense probably damaging 1.00
R9061:Letm1 UTSW 5 33,918,213 (GRCm39) missense probably damaging 1.00
R9420:Letm1 UTSW 5 33,926,802 (GRCm39) missense probably damaging 1.00
S24628:Letm1 UTSW 5 33,904,790 (GRCm39) missense probably benign
S24628:Letm1 UTSW 5 33,904,788 (GRCm39) missense probably benign 0.00
X0066:Letm1 UTSW 5 33,919,915 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCAGAACAGTGCCCTACAATAG -3'
(R):5'- GTATAATGGTGCAGCCCAGGCTTAG -3'

Sequencing Primer
(F):5'- CAGTGCCCTACAATAGGGGAG -3'
(R):5'- TTAGCTGCCTGAGGCTGAC -3'
Posted On 2014-05-14