Incidental Mutation 'R1714:Lrrc8c'
ID190852
Institutional Source Beutler Lab
Gene Symbol Lrrc8c
Ensembl Gene ENSMUSG00000054720
Gene Nameleucine rich repeat containing 8 family, member C
SynonymsE430036I04Rik
MMRRC Submission 039747-MU
Accession Numbers

NCBI RefSeq: NM_133897.2; MGI:2140839

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1714 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location105519388-105613018 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105607291 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 311 (T311A)
Ref Sequence ENSEMBL: ENSMUSP00000066015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067924] [ENSMUST00000153754]
Predicted Effect possibly damaging
Transcript: ENSMUST00000067924
AA Change: T311A

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000066015
Gene: ENSMUSG00000054720
AA Change: T311A

DomainStartEndE-ValueType
Pfam:Pannexin_like 1 338 5.7e-152 PFAM
low complexity region 398 407 N/A INTRINSIC
LRR 588 611 3.97e0 SMART
LRR 613 635 1.81e2 SMART
LRR 636 658 2.2e1 SMART
LRR_TYP 659 682 1.45e-2 SMART
LRR 684 703 3.56e2 SMART
LRR 705 728 2.92e1 SMART
LRR 751 774 1.09e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153754
SMART Domains Protein: ENSMUSP00000114899
Gene: ENSMUSG00000054720

DomainStartEndE-ValueType
Pfam:DUF3733 1 65 4.8e-35 PFAM
low complexity region 78 93 N/A INTRINSIC
Pfam:DUF3733 99 158 1.7e-26 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit a reduction in body weight, white adipose tissue weight, and insulin resistance on a high-fat diet, indicating protection from diet-induced obesity and insulin resistance. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C T 13: 77,316,360 T892I possibly damaging Het
Abcb11 A C 2: 69,306,581 F179V probably damaging Het
Adgrg6 G T 10: 14,439,770 Q597K possibly damaging Het
Ankmy1 G T 1: 92,885,194 Y464* probably null Het
Apba1 G A 19: 23,944,952 E795K possibly damaging Het
Aqp12 T A 1: 93,006,959 V186D possibly damaging Het
Brd8 A T 18: 34,609,833 S253R probably damaging Het
Cdc42se2 A T 11: 54,740,286 S2R possibly damaging Het
Chd9 A C 8: 91,034,225 probably benign Het
Clk4 C T 11: 51,280,418 H219Y probably damaging Het
Cngb1 A G 8: 95,257,931 Y417H probably damaging Het
Cr2 A T 1: 195,151,686 F932I possibly damaging Het
Cxxc1 C A 18: 74,219,863 R415S probably damaging Het
Dclk2 G A 3: 86,906,093 A182V probably benign Het
Ddx11 T G 17: 66,148,759 W718G probably damaging Het
Dmd A C X: 83,964,750 T2069P probably benign Het
Dnaic1 T C 4: 41,632,164 F533L probably benign Het
Dnajc5b A T 3: 19,579,101 R163* probably null Het
Dynll2 T A 11: 87,984,012 probably null Het
Ercc5 A G 1: 44,167,339 T471A probably benign Het
Fan1 T C 7: 64,366,687 D563G probably benign Het
Fbxo34 A G 14: 47,529,201 Y6C probably damaging Het
Fcrl5 T A 3: 87,446,406 S353T probably damaging Het
Gabrb3 A T 7: 57,765,428 Y82F probably damaging Het
Gm20939 C A 17: 94,875,806 P157T probably damaging Het
Haus3 A T 5: 34,163,697 H468Q probably benign Het
Hist1h2ba T C 13: 23,933,952 T69A probably benign Het
Il20ra T C 10: 19,755,828 V259A probably damaging Het
Isg15 A T 4: 156,199,957 V38E probably damaging Het
Kcnq3 A G 15: 66,000,063 S586P probably benign Het
Kl A T 5: 150,953,333 Y206F probably benign Het
Klk1b24 C A 7: 44,191,515 D122E probably damaging Het
Kmt2d A C 15: 98,862,950 S840A unknown Het
Krt34 A G 11: 100,040,127 S150P possibly damaging Het
Lamc3 A G 2: 31,940,757 K1502R probably benign Het
Letm1 G T 5: 33,760,884 R306S possibly damaging Het
Lnx1 C T 5: 74,607,737 G397S probably null Het
Mpeg1 A T 19: 12,462,834 D552V probably damaging Het
Myh11 C T 16: 14,236,368 probably null Het
Ndufa9 T C 6: 126,822,191 probably null Het
Olfr1289 A T 2: 111,483,663 I78F probably damaging Het
Olfr1507 A C 14: 52,490,414 probably null Het
Olfr281 G A 15: 98,456,733 C141Y probably damaging Het
Polr3d A C 14: 70,441,315 M117R possibly damaging Het
Ppp5c T C 7: 17,008,703 I237V probably benign Het
Prrc2c G A 1: 162,677,376 T2632M probably damaging Het
Ptprg C A 14: 12,213,697 Q1022K probably damaging Het
Pus10 T A 11: 23,725,542 H471Q probably damaging Het
Ralgapa1 A G 12: 55,642,389 V1928A probably damaging Het
Rbpms2 CACT CACTACT 9: 65,651,665 probably benign Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Rfpl4 T G 7: 5,110,358 T269P probably benign Het
Rgs10 A G 7: 128,403,222 V72A probably damaging Het
Rsph1 T C 17: 31,255,216 N289S probably benign Het
Sbk2 T C 7: 4,963,122 D21G probably benign Het
Shbg A T 11: 69,617,157 D127E possibly damaging Het
Spag16 A G 1: 69,843,005 E52G probably damaging Het
Ssh2 G A 11: 77,454,024 G945D possibly damaging Het
Sstr3 A T 15: 78,540,273 D91E probably damaging Het
Syne2 C A 12: 76,054,939 A669E probably benign Het
Traf3 A G 12: 111,242,473 I109V probably benign Het
Ube2j1 A G 4: 33,049,886 T295A probably damaging Het
Usp46 A G 5: 74,003,167 V276A probably benign Het
Vmn1r200 T C 13: 22,395,470 S139P possibly damaging Het
Ydjc G A 16: 17,147,799 V143M probably damaging Het
Zfp169 T C 13: 48,498,854 E29G probably benign Het
Zfp292 A G 4: 34,808,935 S1370P probably damaging Het
Zfp763 C T 17: 33,019,617 D185N probably damaging Het
Zfp827 A T 8: 79,060,573 N123Y probably damaging Het
Zfp979 A T 4: 147,613,985 I89N probably damaging Het
Zfr2 T C 10: 81,244,749 L419P probably damaging Het
Other mutations in Lrrc8c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00538:Lrrc8c APN 5 105607210 missense probably damaging 0.99
IGL00736:Lrrc8c APN 5 105607114 missense probably damaging 1.00
IGL00822:Lrrc8c APN 5 105608308 missense probably benign 0.04
IGL02009:Lrrc8c APN 5 105607391 missense probably damaging 1.00
IGL02156:Lrrc8c APN 5 105607493 missense probably damaging 1.00
IGL02266:Lrrc8c APN 5 105608248 missense probably benign 0.30
IGL02268:Lrrc8c APN 5 105607898 missense probably damaging 1.00
IGL02487:Lrrc8c APN 5 105606591 missense probably benign
IGL02536:Lrrc8c APN 5 105607172 missense probably benign 0.00
IGL02672:Lrrc8c APN 5 105607358 missense possibly damaging 0.85
IGL02860:Lrrc8c APN 5 105579615 splice site probably benign
IGL03395:Lrrc8c APN 5 105606629 missense probably benign
P0014:Lrrc8c UTSW 5 105607244 missense probably benign 0.06
PIT4504001:Lrrc8c UTSW 5 105608537 missense probably benign
PIT4651001:Lrrc8c UTSW 5 105608323 missense probably benign 0.04
R0196:Lrrc8c UTSW 5 105606770 missense probably benign 0.18
R0454:Lrrc8c UTSW 5 105607099 missense probably damaging 1.00
R0565:Lrrc8c UTSW 5 105607028 missense probably damaging 0.98
R0673:Lrrc8c UTSW 5 105607678 missense probably damaging 0.99
R0722:Lrrc8c UTSW 5 105579548 missense probably damaging 1.00
R0815:Lrrc8c UTSW 5 105608534 missense probably damaging 1.00
R1177:Lrrc8c UTSW 5 105606836 missense probably benign 0.40
R1411:Lrrc8c UTSW 5 105608179 missense probably damaging 0.96
R1486:Lrrc8c UTSW 5 105607529 missense probably damaging 1.00
R1551:Lrrc8c UTSW 5 105608224 missense probably damaging 1.00
R1662:Lrrc8c UTSW 5 105606757 missense probably benign 0.22
R1770:Lrrc8c UTSW 5 105606737 missense probably damaging 1.00
R2104:Lrrc8c UTSW 5 105607358 missense possibly damaging 0.85
R2139:Lrrc8c UTSW 5 105606692 missense probably damaging 1.00
R4425:Lrrc8c UTSW 5 105607889 missense probably benign 0.22
R4670:Lrrc8c UTSW 5 105608374 missense probably benign
R4897:Lrrc8c UTSW 5 105608089 missense probably benign 0.01
R4968:Lrrc8c UTSW 5 105607127 missense probably damaging 1.00
R5114:Lrrc8c UTSW 5 105607483 missense probably damaging 1.00
R5580:Lrrc8c UTSW 5 105607687 missense probably benign 0.00
R5804:Lrrc8c UTSW 5 105579557 missense possibly damaging 0.88
R5918:Lrrc8c UTSW 5 105608251 missense possibly damaging 0.68
R6293:Lrrc8c UTSW 5 105606746 missense probably damaging 1.00
R6303:Lrrc8c UTSW 5 105608609 missense probably benign 0.31
R6304:Lrrc8c UTSW 5 105608609 missense probably benign 0.31
R7271:Lrrc8c UTSW 5 105607987 missense probably benign 0.02
R7341:Lrrc8c UTSW 5 105607267 missense probably damaging 1.00
R7380:Lrrc8c UTSW 5 105607835 missense possibly damaging 0.71
R7630:Lrrc8c UTSW 5 105607702 missense probably damaging 0.99
R7789:Lrrc8c UTSW 5 105607200 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAACTTCTGGTTCAAATTCCCCG -3'
(R):5'- GAATGTCATCGATTCCCGTCTCCTG -3'

Sequencing Primer
(F):5'- TGAGGTCCCAGTCTCTCAAG -3'
(R):5'- CTGCCGGACATACTCGAAG -3'
Posted On2014-05-14