Incidental Mutation 'R1714:Fan1'
ID 190861
Institutional Source Beutler Lab
Gene Symbol Fan1
Ensembl Gene ENSMUSG00000033458
Gene Name FANCD2/FANCI-associated nuclease 1
Synonyms Mtmr15, 6030441H18Rik
MMRRC Submission 039747-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1714 (G1)
Quality Score 178
Status Not validated
Chromosome 7
Chromosomal Location 63996506-64023843 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 64016435 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 563 (D563G)
Ref Sequence ENSEMBL: ENSMUSP00000130012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163289]
AlphaFold Q69ZT1
Predicted Effect probably benign
Transcript: ENSMUST00000163289
AA Change: D563G

PolyPhen 2 Score 0.289 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000130012
Gene: ENSMUSG00000033458
AA Change: D563G

DomainStartEndE-ValueType
SCOP:d1ihga1 600 737 5e-5 SMART
Blast:VRR_NUC 834 867 2e-12 BLAST
VRR_NUC 896 1011 1.99e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177443
AA Change: D563G

PolyPhen 2 Score 0.289 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000135335
Gene: ENSMUSG00000033458
AA Change: D563G

DomainStartEndE-ValueType
SCOP:d1ihga1 600 737 5e-5 SMART
Blast:VRR_NUC 834 867 2e-12 BLAST
VRR_NUC 896 1011 1.99e-37 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206329
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206730
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206778
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene plays a role in DNA interstrand cross-link repair and encodes a protein with 5' flap endonuclease and 5'-3' exonuclease activity. Mutations in this gene cause karyomegalic interstitial nephritis. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for mutations in this gene display renal tubular karyomegaly with polyploidy and defects in interstrand cross-link DNA repair. Some homozygous mice also display hepatocyte karyomegaly and liver dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C T 13: 77,464,479 (GRCm39) T892I possibly damaging Het
Abcb11 A C 2: 69,136,925 (GRCm39) F179V probably damaging Het
Adgrg6 G T 10: 14,315,514 (GRCm39) Q597K possibly damaging Het
Ankmy1 G T 1: 92,812,916 (GRCm39) Y464* probably null Het
Apba1 G A 19: 23,922,316 (GRCm39) E795K possibly damaging Het
Aqp12 T A 1: 92,934,681 (GRCm39) V186D possibly damaging Het
Brd8 A T 18: 34,742,886 (GRCm39) S253R probably damaging Het
Cdc42se2 A T 11: 54,631,112 (GRCm39) S2R possibly damaging Het
Chd9 A C 8: 91,760,853 (GRCm39) probably benign Het
Clk4 C T 11: 51,171,245 (GRCm39) H219Y probably damaging Het
Cngb1 A G 8: 95,984,559 (GRCm39) Y417H probably damaging Het
Cr2 A T 1: 194,833,994 (GRCm39) F932I possibly damaging Het
Cxxc1 C A 18: 74,352,934 (GRCm39) R415S probably damaging Het
Dclk2 G A 3: 86,813,400 (GRCm39) A182V probably benign Het
Ddx11 T G 17: 66,455,754 (GRCm39) W718G probably damaging Het
Dmd A C X: 83,008,356 (GRCm39) T2069P probably benign Het
Dnai1 T C 4: 41,632,164 (GRCm39) F533L probably benign Het
Dnajc5b A T 3: 19,633,265 (GRCm39) R163* probably null Het
Dynll2 T A 11: 87,874,838 (GRCm39) probably null Het
Ercc5 A G 1: 44,206,499 (GRCm39) T471A probably benign Het
Fbxo34 A G 14: 47,766,658 (GRCm39) Y6C probably damaging Het
Fcrl5 T A 3: 87,353,713 (GRCm39) S353T probably damaging Het
Gabrb3 A T 7: 57,415,176 (GRCm39) Y82F probably damaging Het
Gm20939 C A 17: 95,183,234 (GRCm39) P157T probably damaging Het
H2bc1 T C 13: 24,117,935 (GRCm39) T69A probably benign Het
Haus3 A T 5: 34,321,041 (GRCm39) H468Q probably benign Het
Il20ra T C 10: 19,631,576 (GRCm39) V259A probably damaging Het
Isg15 A T 4: 156,284,414 (GRCm39) V38E probably damaging Het
Kcnq3 A G 15: 65,871,912 (GRCm39) S586P probably benign Het
Kl A T 5: 150,876,798 (GRCm39) Y206F probably benign Het
Klk1b24 C A 7: 43,840,939 (GRCm39) D122E probably damaging Het
Kmt2d A C 15: 98,760,831 (GRCm39) S840A unknown Het
Krt34 A G 11: 99,930,953 (GRCm39) S150P possibly damaging Het
Lamc3 A G 2: 31,830,769 (GRCm39) K1502R probably benign Het
Letm1 G T 5: 33,918,228 (GRCm39) R306S possibly damaging Het
Lnx1 C T 5: 74,768,398 (GRCm39) G397S probably null Het
Lrrc8c A G 5: 105,755,157 (GRCm39) T311A possibly damaging Het
Mpeg1 A T 19: 12,440,198 (GRCm39) D552V probably damaging Het
Myh11 C T 16: 14,054,232 (GRCm39) probably null Het
Ndufa9 T C 6: 126,799,154 (GRCm39) probably null Het
Or4e5 A C 14: 52,727,871 (GRCm39) probably null Het
Or4f4b A T 2: 111,314,008 (GRCm39) I78F probably damaging Het
Or8s8 G A 15: 98,354,614 (GRCm39) C141Y probably damaging Het
Polr3d A C 14: 70,678,755 (GRCm39) M117R possibly damaging Het
Ppp5c T C 7: 16,742,628 (GRCm39) I237V probably benign Het
Prrc2c G A 1: 162,504,945 (GRCm39) T2632M probably damaging Het
Ptprg C A 14: 12,213,697 (GRCm38) Q1022K probably damaging Het
Pus10 T A 11: 23,675,542 (GRCm39) H471Q probably damaging Het
Ralgapa1 A G 12: 55,689,174 (GRCm39) V1928A probably damaging Het
Rbpms2 CACT CACTACT 9: 65,558,947 (GRCm39) probably benign Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,558,948 (GRCm39) probably benign Het
Rfpl4 T G 7: 5,113,357 (GRCm39) T269P probably benign Het
Rgs10 A G 7: 128,004,946 (GRCm39) V72A probably damaging Het
Rsph1 T C 17: 31,474,190 (GRCm39) N289S probably benign Het
Sbk2 T C 7: 4,966,121 (GRCm39) D21G probably benign Het
Shbg A T 11: 69,507,983 (GRCm39) D127E possibly damaging Het
Spag16 A G 1: 69,882,164 (GRCm39) E52G probably damaging Het
Ssh2 G A 11: 77,344,850 (GRCm39) G945D possibly damaging Het
Sstr3 A T 15: 78,424,473 (GRCm39) D91E probably damaging Het
Syne2 C A 12: 76,101,713 (GRCm39) A669E probably benign Het
Traf3 A G 12: 111,208,907 (GRCm39) I109V probably benign Het
Ube2j1 A G 4: 33,049,886 (GRCm39) T295A probably damaging Het
Usp46 A G 5: 74,163,828 (GRCm39) V276A probably benign Het
Vmn1r200 T C 13: 22,579,640 (GRCm39) S139P possibly damaging Het
Ydjc G A 16: 16,965,663 (GRCm39) V143M probably damaging Het
Zfp169 T C 13: 48,652,330 (GRCm39) E29G probably benign Het
Zfp292 A G 4: 34,808,935 (GRCm39) S1370P probably damaging Het
Zfp763 C T 17: 33,238,591 (GRCm39) D185N probably damaging Het
Zfp827 A T 8: 79,787,202 (GRCm39) N123Y probably damaging Het
Zfp979 A T 4: 147,698,442 (GRCm39) I89N probably damaging Het
Zfr2 T C 10: 81,080,583 (GRCm39) L419P probably damaging Het
Other mutations in Fan1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01648:Fan1 APN 7 64,022,297 (GRCm39) missense probably damaging 0.96
IGL01752:Fan1 APN 7 64,022,542 (GRCm39) missense probably benign 0.00
IGL01971:Fan1 APN 7 64,003,459 (GRCm39) missense probably damaging 0.98
IGL02043:Fan1 APN 7 64,021,367 (GRCm39) splice site probably null
IGL02542:Fan1 APN 7 64,014,408 (GRCm39) missense probably damaging 1.00
IGL02731:Fan1 APN 7 64,022,741 (GRCm39) missense possibly damaging 0.86
IGL03111:Fan1 APN 7 63,999,816 (GRCm39) missense possibly damaging 0.67
hitched UTSW 7 64,014,377 (GRCm39) missense probably damaging 1.00
stitched UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R0270:Fan1 UTSW 7 63,998,619 (GRCm39) missense probably benign 0.26
R0632:Fan1 UTSW 7 64,012,947 (GRCm39) missense possibly damaging 0.50
R1750:Fan1 UTSW 7 64,022,761 (GRCm39) missense probably benign 0.14
R1822:Fan1 UTSW 7 64,022,554 (GRCm39) missense probably benign 0.00
R2031:Fan1 UTSW 7 64,004,172 (GRCm39) missense probably damaging 0.98
R2107:Fan1 UTSW 7 64,016,536 (GRCm39) missense probably damaging 1.00
R2126:Fan1 UTSW 7 63,996,636 (GRCm39) missense probably damaging 1.00
R2869:Fan1 UTSW 7 64,012,938 (GRCm39) missense probably benign 0.16
R2869:Fan1 UTSW 7 64,012,938 (GRCm39) missense probably benign 0.16
R2870:Fan1 UTSW 7 64,012,938 (GRCm39) missense probably benign 0.16
R2870:Fan1 UTSW 7 64,012,938 (GRCm39) missense probably benign 0.16
R2871:Fan1 UTSW 7 64,012,938 (GRCm39) missense probably benign 0.16
R2871:Fan1 UTSW 7 64,012,938 (GRCm39) missense probably benign 0.16
R2873:Fan1 UTSW 7 64,012,938 (GRCm39) missense probably benign 0.16
R3849:Fan1 UTSW 7 64,022,119 (GRCm39) missense probably damaging 1.00
R3850:Fan1 UTSW 7 64,022,119 (GRCm39) missense probably damaging 1.00
R3949:Fan1 UTSW 7 64,021,292 (GRCm39) nonsense probably null
R4007:Fan1 UTSW 7 64,016,309 (GRCm39) missense probably damaging 1.00
R4490:Fan1 UTSW 7 64,018,928 (GRCm39) missense possibly damaging 0.84
R4623:Fan1 UTSW 7 64,023,301 (GRCm39) nonsense probably null
R4918:Fan1 UTSW 7 64,023,286 (GRCm39) utr 5 prime probably benign
R5328:Fan1 UTSW 7 64,004,217 (GRCm39) missense probably damaging 1.00
R5691:Fan1 UTSW 7 64,004,118 (GRCm39) splice site probably null
R5902:Fan1 UTSW 7 64,023,070 (GRCm39) splice site probably null
R5905:Fan1 UTSW 7 64,003,399 (GRCm39) missense probably benign 0.00
R6126:Fan1 UTSW 7 64,014,318 (GRCm39) nonsense probably null
R6195:Fan1 UTSW 7 64,004,119 (GRCm39) missense probably damaging 1.00
R6233:Fan1 UTSW 7 64,004,119 (GRCm39) missense probably damaging 1.00
R6405:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R6434:Fan1 UTSW 7 64,004,129 (GRCm39) missense probably damaging 0.99
R6460:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R6469:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R6471:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R6473:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R6696:Fan1 UTSW 7 63,999,826 (GRCm39) missense probably damaging 1.00
R6708:Fan1 UTSW 7 64,022,554 (GRCm39) missense probably benign 0.00
R6713:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R6714:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R6749:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R6841:Fan1 UTSW 7 64,014,377 (GRCm39) missense probably damaging 1.00
R6858:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R6859:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R6860:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R6925:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R6927:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R6936:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R6938:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R6939:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R7040:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R7120:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R7290:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R7292:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R7459:Fan1 UTSW 7 63,998,714 (GRCm39) missense probably damaging 0.99
R7460:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R7464:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R7465:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R7465:Fan1 UTSW 7 64,003,386 (GRCm39) missense probably benign 0.30
R7608:Fan1 UTSW 7 64,003,979 (GRCm39) splice site probably null
R7624:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R7629:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R7682:Fan1 UTSW 7 64,022,512 (GRCm39) missense probably benign 0.06
R7731:Fan1 UTSW 7 64,022,444 (GRCm39) missense probably benign 0.17
R7863:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R8054:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R8055:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R8057:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R8058:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R8101:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R8241:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R8262:Fan1 UTSW 7 64,023,054 (GRCm39) missense probably benign 0.02
R8274:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R8275:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R8276:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R8285:Fan1 UTSW 7 64,016,348 (GRCm39) missense probably damaging 0.96
R8318:Fan1 UTSW 7 63,999,803 (GRCm39) missense probably damaging 1.00
R8402:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R8466:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R8468:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R8799:Fan1 UTSW 7 64,016,406 (GRCm39) missense probably damaging 0.99
R8821:Fan1 UTSW 7 64,004,249 (GRCm39) missense probably damaging 1.00
R9030:Fan1 UTSW 7 64,022,761 (GRCm39) missense probably benign 0.14
R9181:Fan1 UTSW 7 64,016,400 (GRCm39) missense probably damaging 0.98
R9525:Fan1 UTSW 7 64,022,007 (GRCm39) critical splice donor site probably null
R9564:Fan1 UTSW 7 63,999,240 (GRCm39) missense possibly damaging 0.65
R9565:Fan1 UTSW 7 63,999,240 (GRCm39) missense possibly damaging 0.65
R9796:Fan1 UTSW 7 64,022,278 (GRCm39) missense probably benign 0.09
X0025:Fan1 UTSW 7 64,022,583 (GRCm39) missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCCACATTTCCACACTGGCAGG -3'
(R):5'- CTGCGTGTTTCCAACAATGACTGAC -3'

Sequencing Primer
(F):5'- CTTAGCACGGGTATCACAGAGAC -3'
(R):5'- TCCAACAATGACTGACATTTCTC -3'
Posted On 2014-05-14