Incidental Mutation 'R1714:Krt34'
ID 190879
Institutional Source Beutler Lab
Gene Symbol Krt34
Ensembl Gene ENSMUSG00000043485
Gene Name keratin 34
Synonyms 4733401E01Rik, Krt1-4
MMRRC Submission 039747-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R1714 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 99928173-99932380 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 99930953 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 150 (S150P)
Ref Sequence ENSEMBL: ENSMUSP00000056622 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056362]
AlphaFold Q9D646
Predicted Effect possibly damaging
Transcript: ENSMUST00000056362
AA Change: S150P

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000056622
Gene: ENSMUSG00000043485
AA Change: S150P

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
Filament 55 366 7.76e-151 SMART
low complexity region 378 392 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the keratin gene family. As a type I hair keratin, it is an acidic protein which heterodimerizes with type II keratins to form hair and nails. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C T 13: 77,464,479 (GRCm39) T892I possibly damaging Het
Abcb11 A C 2: 69,136,925 (GRCm39) F179V probably damaging Het
Adgrg6 G T 10: 14,315,514 (GRCm39) Q597K possibly damaging Het
Ankmy1 G T 1: 92,812,916 (GRCm39) Y464* probably null Het
Apba1 G A 19: 23,922,316 (GRCm39) E795K possibly damaging Het
Aqp12 T A 1: 92,934,681 (GRCm39) V186D possibly damaging Het
Brd8 A T 18: 34,742,886 (GRCm39) S253R probably damaging Het
Cdc42se2 A T 11: 54,631,112 (GRCm39) S2R possibly damaging Het
Chd9 A C 8: 91,760,853 (GRCm39) probably benign Het
Clk4 C T 11: 51,171,245 (GRCm39) H219Y probably damaging Het
Cngb1 A G 8: 95,984,559 (GRCm39) Y417H probably damaging Het
Cr2 A T 1: 194,833,994 (GRCm39) F932I possibly damaging Het
Cxxc1 C A 18: 74,352,934 (GRCm39) R415S probably damaging Het
Dclk2 G A 3: 86,813,400 (GRCm39) A182V probably benign Het
Ddx11 T G 17: 66,455,754 (GRCm39) W718G probably damaging Het
Dmd A C X: 83,008,356 (GRCm39) T2069P probably benign Het
Dnai1 T C 4: 41,632,164 (GRCm39) F533L probably benign Het
Dnajc5b A T 3: 19,633,265 (GRCm39) R163* probably null Het
Dynll2 T A 11: 87,874,838 (GRCm39) probably null Het
Ercc5 A G 1: 44,206,499 (GRCm39) T471A probably benign Het
Fan1 T C 7: 64,016,435 (GRCm39) D563G probably benign Het
Fbxo34 A G 14: 47,766,658 (GRCm39) Y6C probably damaging Het
Fcrl5 T A 3: 87,353,713 (GRCm39) S353T probably damaging Het
Gabrb3 A T 7: 57,415,176 (GRCm39) Y82F probably damaging Het
Gm20939 C A 17: 95,183,234 (GRCm39) P157T probably damaging Het
H2bc1 T C 13: 24,117,935 (GRCm39) T69A probably benign Het
Haus3 A T 5: 34,321,041 (GRCm39) H468Q probably benign Het
Il20ra T C 10: 19,631,576 (GRCm39) V259A probably damaging Het
Isg15 A T 4: 156,284,414 (GRCm39) V38E probably damaging Het
Kcnq3 A G 15: 65,871,912 (GRCm39) S586P probably benign Het
Kl A T 5: 150,876,798 (GRCm39) Y206F probably benign Het
Klk1b24 C A 7: 43,840,939 (GRCm39) D122E probably damaging Het
Kmt2d A C 15: 98,760,831 (GRCm39) S840A unknown Het
Lamc3 A G 2: 31,830,769 (GRCm39) K1502R probably benign Het
Letm1 G T 5: 33,918,228 (GRCm39) R306S possibly damaging Het
Lnx1 C T 5: 74,768,398 (GRCm39) G397S probably null Het
Lrrc8c A G 5: 105,755,157 (GRCm39) T311A possibly damaging Het
Mpeg1 A T 19: 12,440,198 (GRCm39) D552V probably damaging Het
Myh11 C T 16: 14,054,232 (GRCm39) probably null Het
Ndufa9 T C 6: 126,799,154 (GRCm39) probably null Het
Or4e5 A C 14: 52,727,871 (GRCm39) probably null Het
Or4f4b A T 2: 111,314,008 (GRCm39) I78F probably damaging Het
Or8s8 G A 15: 98,354,614 (GRCm39) C141Y probably damaging Het
Polr3d A C 14: 70,678,755 (GRCm39) M117R possibly damaging Het
Ppp5c T C 7: 16,742,628 (GRCm39) I237V probably benign Het
Prrc2c G A 1: 162,504,945 (GRCm39) T2632M probably damaging Het
Ptprg C A 14: 12,213,697 (GRCm38) Q1022K probably damaging Het
Pus10 T A 11: 23,675,542 (GRCm39) H471Q probably damaging Het
Ralgapa1 A G 12: 55,689,174 (GRCm39) V1928A probably damaging Het
Rbpms2 CACT CACTACT 9: 65,558,947 (GRCm39) probably benign Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,558,948 (GRCm39) probably benign Het
Rfpl4 T G 7: 5,113,357 (GRCm39) T269P probably benign Het
Rgs10 A G 7: 128,004,946 (GRCm39) V72A probably damaging Het
Rsph1 T C 17: 31,474,190 (GRCm39) N289S probably benign Het
Sbk2 T C 7: 4,966,121 (GRCm39) D21G probably benign Het
Shbg A T 11: 69,507,983 (GRCm39) D127E possibly damaging Het
Spag16 A G 1: 69,882,164 (GRCm39) E52G probably damaging Het
Ssh2 G A 11: 77,344,850 (GRCm39) G945D possibly damaging Het
Sstr3 A T 15: 78,424,473 (GRCm39) D91E probably damaging Het
Syne2 C A 12: 76,101,713 (GRCm39) A669E probably benign Het
Traf3 A G 12: 111,208,907 (GRCm39) I109V probably benign Het
Ube2j1 A G 4: 33,049,886 (GRCm39) T295A probably damaging Het
Usp46 A G 5: 74,163,828 (GRCm39) V276A probably benign Het
Vmn1r200 T C 13: 22,579,640 (GRCm39) S139P possibly damaging Het
Ydjc G A 16: 16,965,663 (GRCm39) V143M probably damaging Het
Zfp169 T C 13: 48,652,330 (GRCm39) E29G probably benign Het
Zfp292 A G 4: 34,808,935 (GRCm39) S1370P probably damaging Het
Zfp763 C T 17: 33,238,591 (GRCm39) D185N probably damaging Het
Zfp827 A T 8: 79,787,202 (GRCm39) N123Y probably damaging Het
Zfp979 A T 4: 147,698,442 (GRCm39) I89N probably damaging Het
Zfr2 T C 10: 81,080,583 (GRCm39) L419P probably damaging Het
Other mutations in Krt34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Krt34 APN 11 99,929,520 (GRCm39) splice site probably benign
IGL01323:Krt34 APN 11 99,929,606 (GRCm39) missense possibly damaging 0.95
IGL01403:Krt34 APN 11 99,929,116 (GRCm39) missense possibly damaging 0.88
IGL01453:Krt34 APN 11 99,930,916 (GRCm39) missense probably damaging 1.00
IGL02031:Krt34 APN 11 99,929,849 (GRCm39) missense possibly damaging 0.95
IGL02831:Krt34 APN 11 99,930,973 (GRCm39) splice site probably benign
R0024:Krt34 UTSW 11 99,931,863 (GRCm39) missense probably benign 0.01
R0024:Krt34 UTSW 11 99,931,863 (GRCm39) missense probably benign 0.01
R0220:Krt34 UTSW 11 99,929,519 (GRCm39) splice site probably benign
R0242:Krt34 UTSW 11 99,932,157 (GRCm39) missense probably damaging 1.00
R1573:Krt34 UTSW 11 99,931,854 (GRCm39) missense probably benign 0.01
R1879:Krt34 UTSW 11 99,929,118 (GRCm39) missense possibly damaging 0.76
R3084:Krt34 UTSW 11 99,931,847 (GRCm39) missense probably damaging 1.00
R3692:Krt34 UTSW 11 99,929,857 (GRCm39) missense probably damaging 1.00
R3819:Krt34 UTSW 11 99,930,844 (GRCm39) missense probably damaging 1.00
R3872:Krt34 UTSW 11 99,932,243 (GRCm39) missense probably benign
R3876:Krt34 UTSW 11 99,931,791 (GRCm39) missense probably benign 0.02
R6164:Krt34 UTSW 11 99,929,272 (GRCm39) nonsense probably null
R6338:Krt34 UTSW 11 99,929,316 (GRCm39) missense probably benign 0.00
R6457:Krt34 UTSW 11 99,930,916 (GRCm39) missense probably damaging 1.00
R7728:Krt34 UTSW 11 99,930,811 (GRCm39) critical splice donor site probably null
R7748:Krt34 UTSW 11 99,929,764 (GRCm39) missense probably damaging 1.00
R7903:Krt34 UTSW 11 99,932,321 (GRCm39) start codon destroyed probably null 0.42
R8458:Krt34 UTSW 11 99,930,901 (GRCm39) missense probably damaging 1.00
R8480:Krt34 UTSW 11 99,930,971 (GRCm39) critical splice acceptor site probably null
R9262:Krt34 UTSW 11 99,930,851 (GRCm39) missense probably benign 0.15
R9514:Krt34 UTSW 11 99,929,226 (GRCm39) missense probably damaging 1.00
Z1176:Krt34 UTSW 11 99,932,260 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGATTTGGGAAGCCTCTCTGGATG -3'
(R):5'- CAAGAACAGACTGAGGGTTCCACC -3'

Sequencing Primer
(F):5'- TCACTCTGAGGCTGTGAAAC -3'
(R):5'- CAGACTGAGGGTTCCACCTTATG -3'
Posted On 2014-05-14