Mutagenetix > Incidental Mutations

Incidental Mutation 'R1714:Traf3'

190882

Institutional Source

Beutler Lab

Gene Symbol

Traf3

Ensembl Gene

ENSMUSG00000021277

Gene Name

TNF receptor-associated factor 3

Synonyms

LAP1, CRAF1, CD40bp, CAP-1

MMRRC Submission

039747-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1714 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

111166370-111267153 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 111242473 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 109 (I109V)

Ref Sequence

ENSEMBL: ENSMUSP00000112517 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021706] [ENSMUST00000060274] [ENSMUST00000117269] [ENSMUST00000139162]

Predicted Effect

probably benign
Transcript: ENSMUST00000021706
AA Change: I109V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000021706
Gene: ENSMUSG00000021277
AA Change: I109V

Domain	Start	End	E-Value	Type
RING	52	87	5.85e-2	SMART
Pfam:zf-TRAF	135	191	4.6e-18	PFAM
Pfam:zf-TRAF	191	250	9.9e-14	PFAM
coiled coil region	298	337	N/A	INTRINSIC
MATH	419	542	5.69e-18	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000060274
AA Change: I109V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000058361
Gene: ENSMUSG00000021277
AA Change: I109V

Domain	Start	End	E-Value	Type
RING	52	87	5.85e-2	SMART
Pfam:zf-TRAF	135	191	1.5e-17	PFAM
coiled coil region	273	312	N/A	INTRINSIC
MATH	394	517	5.69e-18	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000117269
AA Change: I109V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000112517
Gene: ENSMUSG00000021277
AA Change: I109V

Domain	Start	End	E-Value	Type
RING	52	87	5.85e-2	SMART
Pfam:zf-TRAF	135	191	1.5e-17	PFAM
coiled coil region	273	312	N/A	INTRINSIC
MATH	394	517	5.69e-18	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000139162

SMART Domains

Protein: ENSMUSP00000119010
Gene: ENSMUSG00000021277

Domain	Start	End	E-Value	Type
RING	52	87	5.85e-2	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF receptor associated factor (TRAF) protein family. TRAF proteins associate with, and mediate the signal transduction from, members of the TNF receptor (TNFR) superfamily. This protein participates in the signal transduction of CD40, a TNFR family member important for the activation of the immune response. This protein is found to be a critical component of the lymphotoxin-beta receptor (LTbetaR) signaling complex, which induces NF-kappaB activation and cell death initiated by LTbeta ligation. Epstein-Barr virus encoded latent infection membrane protein-1 (LMP1) can interact with this and several other members of the TRAF family, which may be essential for the oncogenic effects of LMP1. Several alternatively spliced transcript variants encoding three distinct isoforms have been reported. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygous mutation of this gene results in progressive runting, hypoglycemia, and depletion of peripheral white blood cells, leading to death by 10 days of age. Immune responses to T-dependent antigen are impaired in lethally irradiated mice reconstituted with mutant cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	C	T	13: 77,316,360	T892I	possibly damaging	Het
Abcb11	A	C	2: 69,306,581	F179V	probably damaging	Het
Adgrg6	G	T	10: 14,439,770	Q597K	possibly damaging	Het
Ankmy1	G	T	1: 92,885,194	Y464*	probably null	Het
Apba1	G	A	19: 23,944,952	E795K	possibly damaging	Het
Aqp12	T	A	1: 93,006,959	V186D	possibly damaging	Het
Brd8	A	T	18: 34,609,833	S253R	probably damaging	Het
Cdc42se2	A	T	11: 54,740,286	S2R	possibly damaging	Het
Chd9	A	C	8: 91,034,225		probably benign	Het
Clk4	C	T	11: 51,280,418	H219Y	probably damaging	Het
Cngb1	A	G	8: 95,257,931	Y417H	probably damaging	Het
Cr2	A	T	1: 195,151,686	F932I	possibly damaging	Het
Cxxc1	C	A	18: 74,219,863	R415S	probably damaging	Het
Dclk2	G	A	3: 86,906,093	A182V	probably benign	Het
Ddx11	T	G	17: 66,148,759	W718G	probably damaging	Het
Dmd	A	C	X: 83,964,750	T2069P	probably benign	Het
Dnaic1	T	C	4: 41,632,164	F533L	probably benign	Het
Dnajc5b	A	T	3: 19,579,101	R163*	probably null	Het
Dynll2	T	A	11: 87,984,012		probably null	Het
Ercc5	A	G	1: 44,167,339	T471A	probably benign	Het
Fan1	T	C	7: 64,366,687	D563G	probably benign	Het
Fbxo34	A	G	14: 47,529,201	Y6C	probably damaging	Het
Fcrl5	T	A	3: 87,446,406	S353T	probably damaging	Het
Gabrb3	A	T	7: 57,765,428	Y82F	probably damaging	Het
Gm20939	C	A	17: 94,875,806	P157T	probably damaging	Het
Haus3	A	T	5: 34,163,697	H468Q	probably benign	Het
Hist1h2ba	T	C	13: 23,933,952	T69A	probably benign	Het
Il20ra	T	C	10: 19,755,828	V259A	probably damaging	Het
Isg15	A	T	4: 156,199,957	V38E	probably damaging	Het
Kcnq3	A	G	15: 66,000,063	S586P	probably benign	Het
Kl	A	T	5: 150,953,333	Y206F	probably benign	Het
Klk1b24	C	A	7: 44,191,515	D122E	probably damaging	Het
Kmt2d	A	C	15: 98,862,950	S840A	unknown	Het
Krt34	A	G	11: 100,040,127	S150P	possibly damaging	Het
Lamc3	A	G	2: 31,940,757	K1502R	probably benign	Het
Letm1	G	T	5: 33,760,884	R306S	possibly damaging	Het
Lnx1	C	T	5: 74,607,737	G397S	probably null	Het
Lrrc8c	A	G	5: 105,607,291	T311A	possibly damaging	Het
Mpeg1	A	T	19: 12,462,834	D552V	probably damaging	Het
Myh11	C	T	16: 14,236,368		probably null	Het
Ndufa9	T	C	6: 126,822,191		probably null	Het
Olfr1289	A	T	2: 111,483,663	I78F	probably damaging	Het
Olfr1507	A	C	14: 52,490,414		probably null	Het
Olfr281	G	A	15: 98,456,733	C141Y	probably damaging	Het
Polr3d	A	C	14: 70,441,315	M117R	possibly damaging	Het
Ppp5c	T	C	7: 17,008,703	I237V	probably benign	Het
Prrc2c	G	A	1: 162,677,376	T2632M	probably damaging	Het
Ptprg	C	A	14: 12,213,697	Q1022K	probably damaging	Het
Pus10	T	A	11: 23,725,542	H471Q	probably damaging	Het
Ralgapa1	A	G	12: 55,642,389	V1928A	probably damaging	Het
Rbpms2	CACT	CACTACT	9: 65,651,665		probably benign	Het
Rbpms2	ACTGCTGCTGCTGCTGC	ACTGCTGCTGCTGCTGCTGC	9: 65,651,666		probably benign	Het
Rfpl4	T	G	7: 5,110,358	T269P	probably benign	Het
Rgs10	A	G	7: 128,403,222	V72A	probably damaging	Het
Rsph1	T	C	17: 31,255,216	N289S	probably benign	Het
Sbk2	T	C	7: 4,963,122	D21G	probably benign	Het
Shbg	A	T	11: 69,617,157	D127E	possibly damaging	Het
Spag16	A	G	1: 69,843,005	E52G	probably damaging	Het
Ssh2	G	A	11: 77,454,024	G945D	possibly damaging	Het
Sstr3	A	T	15: 78,540,273	D91E	probably damaging	Het
Syne2	C	A	12: 76,054,939	A669E	probably benign	Het
Ube2j1	A	G	4: 33,049,886	T295A	probably damaging	Het
Usp46	A	G	5: 74,003,167	V276A	probably benign	Het
Vmn1r200	T	C	13: 22,395,470	S139P	possibly damaging	Het
Ydjc	G	A	16: 17,147,799	V143M	probably damaging	Het
Zfp169	T	C	13: 48,498,854	E29G	probably benign	Het
Zfp292	A	G	4: 34,808,935	S1370P	probably damaging	Het
Zfp763	C	T	17: 33,019,617	D185N	probably damaging	Het
Zfp827	A	T	8: 79,060,573	N123Y	probably damaging	Het
Zfp979	A	T	4: 147,613,985	I89N	probably damaging	Het
Zfr2	T	C	10: 81,244,749	L419P	probably damaging	Het

Other mutations in Traf3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00420:Traf3	APN	12	111239067	missense	probably damaging	0.99
IGL02015:Traf3	APN	12	111252740	missense	probably benign
IGL02318:Traf3	APN	12	111237597	missense	probably benign
IGL02429:Traf3	APN	12	111243465	missense	probably benign	0.19
IGL03088:Traf3	APN	12	111261843	missense	probably damaging	0.99
bananasplit	UTSW	12	111262036	missense	probably damaging	1.00
Han	UTSW	12	111261576	missense	probably damaging	1.00
Hulk	UTSW	12	111261576	missense	probably damaging	1.00
sundae	UTSW	12	111255224	missense	possibly damaging	0.80
R0023:Traf3	UTSW	12	111243478	nonsense	probably null
R0143:Traf3	UTSW	12	111261576	missense	probably damaging	1.00
R1453:Traf3	UTSW	12	111255323	missense	probably damaging	0.96
R1507:Traf3	UTSW	12	111260760	missense	probably benign	0.30
R1651:Traf3	UTSW	12	111262036	missense	probably damaging	1.00
R1996:Traf3	UTSW	12	111260661	missense	probably benign	0.21
R1997:Traf3	UTSW	12	111260661	missense	probably benign	0.21
R3946:Traf3	UTSW	12	111255245	missense	possibly damaging	0.91
R4477:Traf3	UTSW	12	111248602	missense	probably benign	0.00
R4645:Traf3	UTSW	12	111261966	missense	probably damaging	1.00
R4723:Traf3	UTSW	12	111262036	missense	probably damaging	1.00
R4820:Traf3	UTSW	12	111260770	missense	possibly damaging	0.96
R5123:Traf3	UTSW	12	111243518	missense	possibly damaging	0.52
R5775:Traf3	UTSW	12	111252728	missense	possibly damaging	0.91
R5825:Traf3	UTSW	12	111255361	missense	probably benign	0.03
R5912:Traf3	UTSW	12	111255349	missense	probably benign	0.01
R6611:Traf3	UTSW	12	111237640	missense	possibly damaging	0.76
R6933:Traf3	UTSW	12	111255224	missense	possibly damaging	0.80
R7389:Traf3	UTSW	12	111237753	missense	probably damaging	1.00
R7425:Traf3	UTSW	12	111260661	nonsense	probably null
R8512:Traf3	UTSW	12	111261992	missense	probably benign	0.06
X0052:Traf3	UTSW	12	111252736	missense	probably benign	0.41
Z1176:Traf3	UTSW	12	111261836	missense	probably damaging	1.00
Z1177:Traf3	UTSW	12	111261492	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- GTTTCGCACAGCGTTCTAAGACATC -3'
(R):5'- ACACATGCTACATCTCCCTGGCAG -3'

Sequencing Primer
(F):5'- GGCCATGTGCTCAAAAATGTC -3'
(R):5'- TTACCAGCAGATGTCCCAGA -3'

Posted On

2014-05-14