Incidental Mutation 'R1714:2210408I21Rik'
ID 190886
Institutional Source Beutler Lab
Gene Symbol 2210408I21Rik
Ensembl Gene ENSMUSG00000071252
Gene Name RIKEN cDNA 2210408I21 gene
Synonyms
MMRRC Submission 039747-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1714 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 77283659-77761903 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 77464479 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 892 (T892I)
Ref Sequence ENSEMBL: ENSMUSP00000127449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168779]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000168779
AA Change: T892I

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127449
Gene: ENSMUSG00000071252
AA Change: T892I

DomainStartEndE-ValueType
low complexity region 121 133 N/A INTRINSIC
low complexity region 151 164 N/A INTRINSIC
Pfam:DUF4495 515 832 1.6e-140 PFAM
low complexity region 1241 1255 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A C 2: 69,136,925 (GRCm39) F179V probably damaging Het
Adgrg6 G T 10: 14,315,514 (GRCm39) Q597K possibly damaging Het
Ankmy1 G T 1: 92,812,916 (GRCm39) Y464* probably null Het
Apba1 G A 19: 23,922,316 (GRCm39) E795K possibly damaging Het
Aqp12 T A 1: 92,934,681 (GRCm39) V186D possibly damaging Het
Brd8 A T 18: 34,742,886 (GRCm39) S253R probably damaging Het
Cdc42se2 A T 11: 54,631,112 (GRCm39) S2R possibly damaging Het
Chd9 A C 8: 91,760,853 (GRCm39) probably benign Het
Clk4 C T 11: 51,171,245 (GRCm39) H219Y probably damaging Het
Cngb1 A G 8: 95,984,559 (GRCm39) Y417H probably damaging Het
Cr2 A T 1: 194,833,994 (GRCm39) F932I possibly damaging Het
Cxxc1 C A 18: 74,352,934 (GRCm39) R415S probably damaging Het
Dclk2 G A 3: 86,813,400 (GRCm39) A182V probably benign Het
Ddx11 T G 17: 66,455,754 (GRCm39) W718G probably damaging Het
Dmd A C X: 83,008,356 (GRCm39) T2069P probably benign Het
Dnai1 T C 4: 41,632,164 (GRCm39) F533L probably benign Het
Dnajc5b A T 3: 19,633,265 (GRCm39) R163* probably null Het
Dynll2 T A 11: 87,874,838 (GRCm39) probably null Het
Ercc5 A G 1: 44,206,499 (GRCm39) T471A probably benign Het
Fan1 T C 7: 64,016,435 (GRCm39) D563G probably benign Het
Fbxo34 A G 14: 47,766,658 (GRCm39) Y6C probably damaging Het
Fcrl5 T A 3: 87,353,713 (GRCm39) S353T probably damaging Het
Gabrb3 A T 7: 57,415,176 (GRCm39) Y82F probably damaging Het
Gm20939 C A 17: 95,183,234 (GRCm39) P157T probably damaging Het
H2bc1 T C 13: 24,117,935 (GRCm39) T69A probably benign Het
Haus3 A T 5: 34,321,041 (GRCm39) H468Q probably benign Het
Il20ra T C 10: 19,631,576 (GRCm39) V259A probably damaging Het
Isg15 A T 4: 156,284,414 (GRCm39) V38E probably damaging Het
Kcnq3 A G 15: 65,871,912 (GRCm39) S586P probably benign Het
Kl A T 5: 150,876,798 (GRCm39) Y206F probably benign Het
Klk1b24 C A 7: 43,840,939 (GRCm39) D122E probably damaging Het
Kmt2d A C 15: 98,760,831 (GRCm39) S840A unknown Het
Krt34 A G 11: 99,930,953 (GRCm39) S150P possibly damaging Het
Lamc3 A G 2: 31,830,769 (GRCm39) K1502R probably benign Het
Letm1 G T 5: 33,918,228 (GRCm39) R306S possibly damaging Het
Lnx1 C T 5: 74,768,398 (GRCm39) G397S probably null Het
Lrrc8c A G 5: 105,755,157 (GRCm39) T311A possibly damaging Het
Mpeg1 A T 19: 12,440,198 (GRCm39) D552V probably damaging Het
Myh11 C T 16: 14,054,232 (GRCm39) probably null Het
Ndufa9 T C 6: 126,799,154 (GRCm39) probably null Het
Or4e5 A C 14: 52,727,871 (GRCm39) probably null Het
Or4f4b A T 2: 111,314,008 (GRCm39) I78F probably damaging Het
Or8s8 G A 15: 98,354,614 (GRCm39) C141Y probably damaging Het
Polr3d A C 14: 70,678,755 (GRCm39) M117R possibly damaging Het
Ppp5c T C 7: 16,742,628 (GRCm39) I237V probably benign Het
Prrc2c G A 1: 162,504,945 (GRCm39) T2632M probably damaging Het
Ptprg C A 14: 12,213,697 (GRCm38) Q1022K probably damaging Het
Pus10 T A 11: 23,675,542 (GRCm39) H471Q probably damaging Het
Ralgapa1 A G 12: 55,689,174 (GRCm39) V1928A probably damaging Het
Rbpms2 CACT CACTACT 9: 65,558,947 (GRCm39) probably benign Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,558,948 (GRCm39) probably benign Het
Rfpl4 T G 7: 5,113,357 (GRCm39) T269P probably benign Het
Rgs10 A G 7: 128,004,946 (GRCm39) V72A probably damaging Het
Rsph1 T C 17: 31,474,190 (GRCm39) N289S probably benign Het
Sbk2 T C 7: 4,966,121 (GRCm39) D21G probably benign Het
Shbg A T 11: 69,507,983 (GRCm39) D127E possibly damaging Het
Spag16 A G 1: 69,882,164 (GRCm39) E52G probably damaging Het
Ssh2 G A 11: 77,344,850 (GRCm39) G945D possibly damaging Het
Sstr3 A T 15: 78,424,473 (GRCm39) D91E probably damaging Het
Syne2 C A 12: 76,101,713 (GRCm39) A669E probably benign Het
Traf3 A G 12: 111,208,907 (GRCm39) I109V probably benign Het
Ube2j1 A G 4: 33,049,886 (GRCm39) T295A probably damaging Het
Usp46 A G 5: 74,163,828 (GRCm39) V276A probably benign Het
Vmn1r200 T C 13: 22,579,640 (GRCm39) S139P possibly damaging Het
Ydjc G A 16: 16,965,663 (GRCm39) V143M probably damaging Het
Zfp169 T C 13: 48,652,330 (GRCm39) E29G probably benign Het
Zfp292 A G 4: 34,808,935 (GRCm39) S1370P probably damaging Het
Zfp763 C T 17: 33,238,591 (GRCm39) D185N probably damaging Het
Zfp827 A T 8: 79,787,202 (GRCm39) N123Y probably damaging Het
Zfp979 A T 4: 147,698,442 (GRCm39) I89N probably damaging Het
Zfr2 T C 10: 81,080,583 (GRCm39) L419P probably damaging Het
Other mutations in 2210408I21Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:2210408I21Rik APN 13 77,471,477 (GRCm39) splice site probably benign
IGL01154:2210408I21Rik APN 13 77,429,213 (GRCm39) missense probably benign 0.01
IGL01461:2210408I21Rik APN 13 77,429,214 (GRCm39) missense probably benign 0.25
IGL01624:2210408I21Rik APN 13 77,341,205 (GRCm39) missense probably damaging 0.99
IGL02033:2210408I21Rik APN 13 77,407,995 (GRCm39) missense possibly damaging 0.90
IGL02621:2210408I21Rik APN 13 77,408,150 (GRCm39) missense possibly damaging 0.92
IGL02718:2210408I21Rik APN 13 77,322,991 (GRCm39) missense probably damaging 1.00
IGL02823:2210408I21Rik APN 13 77,410,074 (GRCm39) missense probably damaging 0.96
IGL02859:2210408I21Rik APN 13 77,415,818 (GRCm39) missense possibly damaging 0.71
IGL03006:2210408I21Rik APN 13 77,471,891 (GRCm39) critical splice donor site probably null
IGL03072:2210408I21Rik APN 13 77,408,116 (GRCm39) missense probably benign
IGL03184:2210408I21Rik APN 13 77,471,570 (GRCm39) missense possibly damaging 0.63
IGL03275:2210408I21Rik APN 13 77,446,674 (GRCm39) missense possibly damaging 0.71
PIT4651001:2210408I21Rik UTSW 13 77,408,014 (GRCm39) missense probably benign
R0226:2210408I21Rik UTSW 13 77,451,544 (GRCm39) missense possibly damaging 0.86
R0323:2210408I21Rik UTSW 13 77,446,674 (GRCm39) missense possibly damaging 0.71
R0614:2210408I21Rik UTSW 13 77,340,782 (GRCm39) missense probably benign 0.26
R0894:2210408I21Rik UTSW 13 77,471,726 (GRCm39) missense probably benign 0.18
R1165:2210408I21Rik UTSW 13 77,482,406 (GRCm39) missense probably benign 0.06
R1509:2210408I21Rik UTSW 13 77,340,766 (GRCm39) missense probably benign
R1711:2210408I21Rik UTSW 13 77,418,039 (GRCm39) missense possibly damaging 0.93
R1718:2210408I21Rik UTSW 13 77,393,489 (GRCm39) intron probably benign
R1836:2210408I21Rik UTSW 13 77,471,493 (GRCm39) missense probably benign 0.00
R1893:2210408I21Rik UTSW 13 77,415,928 (GRCm39) missense possibly damaging 0.93
R2035:2210408I21Rik UTSW 13 77,760,761 (GRCm39) makesense probably null
R2329:2210408I21Rik UTSW 13 77,451,444 (GRCm39) missense probably benign 0.04
R2897:2210408I21Rik UTSW 13 77,471,640 (GRCm39) missense probably benign 0.33
R3688:2210408I21Rik UTSW 13 77,415,968 (GRCm39) missense possibly damaging 0.52
R4153:2210408I21Rik UTSW 13 77,341,292 (GRCm39) missense probably benign 0.00
R4387:2210408I21Rik UTSW 13 77,464,693 (GRCm39) critical splice donor site probably null
R4388:2210408I21Rik UTSW 13 77,464,693 (GRCm39) critical splice donor site probably null
R4499:2210408I21Rik UTSW 13 77,464,646 (GRCm39) missense possibly damaging 0.96
R4614:2210408I21Rik UTSW 13 77,402,375 (GRCm39) splice site probably null
R4798:2210408I21Rik UTSW 13 77,471,843 (GRCm39) missense possibly damaging 0.96
R4943:2210408I21Rik UTSW 13 77,393,446 (GRCm39) missense possibly damaging 0.86
R5045:2210408I21Rik UTSW 13 77,415,927 (GRCm39) splice site probably null
R5387:2210408I21Rik UTSW 13 77,408,092 (GRCm39) missense probably benign 0.11
R5500:2210408I21Rik UTSW 13 77,451,508 (GRCm39) missense probably benign 0.33
R5686:2210408I21Rik UTSW 13 77,451,433 (GRCm39) missense possibly damaging 0.72
R6111:2210408I21Rik UTSW 13 77,476,021 (GRCm39) missense possibly damaging 0.72
R6135:2210408I21Rik UTSW 13 77,402,335 (GRCm39) missense probably damaging 0.98
R6188:2210408I21Rik UTSW 13 77,331,850 (GRCm39) missense possibly damaging 0.53
R6388:2210408I21Rik UTSW 13 77,410,230 (GRCm39) missense probably benign
R6588:2210408I21Rik UTSW 13 77,340,766 (GRCm39) missense probably benign
R6632:2210408I21Rik UTSW 13 77,429,186 (GRCm39) missense possibly damaging 0.86
R6638:2210408I21Rik UTSW 13 77,451,521 (GRCm39) missense probably benign 0.07
R6755:2210408I21Rik UTSW 13 77,475,994 (GRCm39) missense probably benign
R6971:2210408I21Rik UTSW 13 77,341,306 (GRCm39) missense possibly damaging 0.90
R7079:2210408I21Rik UTSW 13 77,402,323 (GRCm39) missense possibly damaging 0.86
R7130:2210408I21Rik UTSW 13 77,418,021 (GRCm39) missense possibly damaging 0.93
R7215:2210408I21Rik UTSW 13 77,471,690 (GRCm39) missense possibly damaging 0.96
R7272:2210408I21Rik UTSW 13 77,471,655 (GRCm39) missense probably benign 0.00
R7331:2210408I21Rik UTSW 13 77,331,728 (GRCm39) missense possibly damaging 0.53
R7561:2210408I21Rik UTSW 13 77,341,314 (GRCm39) missense probably benign
R7684:2210408I21Rik UTSW 13 77,760,659 (GRCm39) nonsense probably null
R7728:2210408I21Rik UTSW 13 77,464,596 (GRCm39) missense possibly damaging 0.96
R7881:2210408I21Rik UTSW 13 77,471,685 (GRCm39) missense possibly damaging 0.53
R7963:2210408I21Rik UTSW 13 77,340,673 (GRCm39) missense probably benign 0.02
R8008:2210408I21Rik UTSW 13 77,429,234 (GRCm39) missense probably benign 0.28
R8024:2210408I21Rik UTSW 13 77,760,713 (GRCm39) missense probably benign
R8170:2210408I21Rik UTSW 13 77,411,713 (GRCm39) missense probably benign 0.06
R8201:2210408I21Rik UTSW 13 77,341,278 (GRCm39) missense possibly damaging 0.72
R8255:2210408I21Rik UTSW 13 77,415,850 (GRCm39) missense possibly damaging 0.71
R8296:2210408I21Rik UTSW 13 77,415,896 (GRCm39) missense probably damaging 0.98
R8476:2210408I21Rik UTSW 13 77,410,020 (GRCm39) missense possibly damaging 0.92
R8526:2210408I21Rik UTSW 13 77,417,935 (GRCm39) nonsense probably null
R8746:2210408I21Rik UTSW 13 77,451,529 (GRCm39) missense probably benign 0.01
R8812:2210408I21Rik UTSW 13 77,480,471 (GRCm39) missense probably damaging 0.98
R8870:2210408I21Rik UTSW 13 77,471,840 (GRCm39) missense possibly damaging 0.96
R8885:2210408I21Rik UTSW 13 77,471,525 (GRCm39) missense possibly damaging 0.91
R8910:2210408I21Rik UTSW 13 77,471,768 (GRCm39) missense probably benign 0.03
R8911:2210408I21Rik UTSW 13 77,429,234 (GRCm39) missense probably benign 0.28
R8965:2210408I21Rik UTSW 13 77,760,723 (GRCm39) missense probably benign 0.02
R8968:2210408I21Rik UTSW 13 77,480,429 (GRCm39) nonsense probably null
R8989:2210408I21Rik UTSW 13 77,760,724 (GRCm39) missense probably benign 0.01
R9163:2210408I21Rik UTSW 13 77,393,400 (GRCm39) missense possibly damaging 0.73
R9378:2210408I21Rik UTSW 13 77,471,735 (GRCm39) missense possibly damaging 0.53
R9478:2210408I21Rik UTSW 13 77,451,573 (GRCm39) missense possibly damaging 0.53
R9523:2210408I21Rik UTSW 13 77,407,988 (GRCm39) missense possibly damaging 0.53
R9595:2210408I21Rik UTSW 13 77,464,566 (GRCm39) missense probably benign
X0066:2210408I21Rik UTSW 13 77,331,759 (GRCm39) missense possibly damaging 0.72
Z1088:2210408I21Rik UTSW 13 77,323,010 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTACACAGTTCCTGCTGCACTACC -3'
(R):5'- CCATCCTTGTGGAATGCTCTGAAGC -3'

Sequencing Primer
(F):5'- GGGGAAACCTCTCTTTCAAATGG -3'
(R):5'- CTCTGAAGCAGATGATCAGGAAC -3'
Posted On 2014-05-14