Incidental Mutation 'R1714:Fbxo34'
ID190889
Institutional Source Beutler Lab
Gene Symbol Fbxo34
Ensembl Gene ENSMUSG00000037536
Gene NameF-box protein 34
Synonyms5830426G16Rik, 2900057B08Rik
MMRRC Submission 039747-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R1714 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location47450421-47531962 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 47529201 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 6 (Y6C)
Ref Sequence ENSEMBL: ENSMUSP00000154437 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043112] [ENSMUST00000095941] [ENSMUST00000163324] [ENSMUST00000165714] [ENSMUST00000168833] [ENSMUST00000226395] [ENSMUST00000226432] [ENSMUST00000226954] [ENSMUST00000228019] [ENSMUST00000228668] [ENSMUST00000228740]
Predicted Effect probably damaging
Transcript: ENSMUST00000043112
AA Change: Y57C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044675
Gene: ENSMUSG00000037536
AA Change: Y57C

DomainStartEndE-ValueType
low complexity region 8 45 N/A INTRINSIC
FBOX 613 653 1.84e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000095941
AA Change: Y6C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093634
Gene: ENSMUSG00000037536
AA Change: Y6C

DomainStartEndE-ValueType
FBOX 562 602 1.84e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000163324
AA Change: Y6C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131708
Gene: ENSMUSG00000037536
AA Change: Y6C

DomainStartEndE-ValueType
FBOX 562 602 1.84e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165714
AA Change: Y6C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130036
Gene: ENSMUSG00000037536
AA Change: Y6C

DomainStartEndE-ValueType
FBOX 562 602 1.84e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168833
AA Change: Y6C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132271
Gene: ENSMUSG00000037536
AA Change: Y6C

DomainStartEndE-ValueType
FBOX 562 602 1.84e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000226395
AA Change: Y6C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000226432
AA Change: Y6C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000226954
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227162
Predicted Effect probably benign
Transcript: ENSMUST00000227601
Predicted Effect probably benign
Transcript: ENSMUST00000228019
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228634
Predicted Effect probably damaging
Transcript: ENSMUST00000228668
AA Change: Y6C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000228740
AA Change: Y6C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the F-box protein family, such as FBXO34, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C T 13: 77,316,360 T892I possibly damaging Het
Abcb11 A C 2: 69,306,581 F179V probably damaging Het
Adgrg6 G T 10: 14,439,770 Q597K possibly damaging Het
Ankmy1 G T 1: 92,885,194 Y464* probably null Het
Apba1 G A 19: 23,944,952 E795K possibly damaging Het
Aqp12 T A 1: 93,006,959 V186D possibly damaging Het
Brd8 A T 18: 34,609,833 S253R probably damaging Het
Cdc42se2 A T 11: 54,740,286 S2R possibly damaging Het
Chd9 A C 8: 91,034,225 probably benign Het
Clk4 C T 11: 51,280,418 H219Y probably damaging Het
Cngb1 A G 8: 95,257,931 Y417H probably damaging Het
Cr2 A T 1: 195,151,686 F932I possibly damaging Het
Cxxc1 C A 18: 74,219,863 R415S probably damaging Het
Dclk2 G A 3: 86,906,093 A182V probably benign Het
Ddx11 T G 17: 66,148,759 W718G probably damaging Het
Dmd A C X: 83,964,750 T2069P probably benign Het
Dnaic1 T C 4: 41,632,164 F533L probably benign Het
Dnajc5b A T 3: 19,579,101 R163* probably null Het
Dynll2 T A 11: 87,984,012 probably null Het
Ercc5 A G 1: 44,167,339 T471A probably benign Het
Fan1 T C 7: 64,366,687 D563G probably benign Het
Fcrl5 T A 3: 87,446,406 S353T probably damaging Het
Gabrb3 A T 7: 57,765,428 Y82F probably damaging Het
Gm20939 C A 17: 94,875,806 P157T probably damaging Het
Haus3 A T 5: 34,163,697 H468Q probably benign Het
Hist1h2ba T C 13: 23,933,952 T69A probably benign Het
Il20ra T C 10: 19,755,828 V259A probably damaging Het
Isg15 A T 4: 156,199,957 V38E probably damaging Het
Kcnq3 A G 15: 66,000,063 S586P probably benign Het
Kl A T 5: 150,953,333 Y206F probably benign Het
Klk1b24 C A 7: 44,191,515 D122E probably damaging Het
Kmt2d A C 15: 98,862,950 S840A unknown Het
Krt34 A G 11: 100,040,127 S150P possibly damaging Het
Lamc3 A G 2: 31,940,757 K1502R probably benign Het
Letm1 G T 5: 33,760,884 R306S possibly damaging Het
Lnx1 C T 5: 74,607,737 G397S probably null Het
Lrrc8c A G 5: 105,607,291 T311A possibly damaging Het
Mpeg1 A T 19: 12,462,834 D552V probably damaging Het
Myh11 C T 16: 14,236,368 probably null Het
Ndufa9 T C 6: 126,822,191 probably null Het
Olfr1289 A T 2: 111,483,663 I78F probably damaging Het
Olfr1507 A C 14: 52,490,414 probably null Het
Olfr281 G A 15: 98,456,733 C141Y probably damaging Het
Polr3d A C 14: 70,441,315 M117R possibly damaging Het
Ppp5c T C 7: 17,008,703 I237V probably benign Het
Prrc2c G A 1: 162,677,376 T2632M probably damaging Het
Ptprg C A 14: 12,213,697 Q1022K probably damaging Het
Pus10 T A 11: 23,725,542 H471Q probably damaging Het
Ralgapa1 A G 12: 55,642,389 V1928A probably damaging Het
Rbpms2 CACT CACTACT 9: 65,651,665 probably benign Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Rfpl4 T G 7: 5,110,358 T269P probably benign Het
Rgs10 A G 7: 128,403,222 V72A probably damaging Het
Rsph1 T C 17: 31,255,216 N289S probably benign Het
Sbk2 T C 7: 4,963,122 D21G probably benign Het
Shbg A T 11: 69,617,157 D127E possibly damaging Het
Spag16 A G 1: 69,843,005 E52G probably damaging Het
Ssh2 G A 11: 77,454,024 G945D possibly damaging Het
Sstr3 A T 15: 78,540,273 D91E probably damaging Het
Syne2 C A 12: 76,054,939 A669E probably benign Het
Traf3 A G 12: 111,242,473 I109V probably benign Het
Ube2j1 A G 4: 33,049,886 T295A probably damaging Het
Usp46 A G 5: 74,003,167 V276A probably benign Het
Vmn1r200 T C 13: 22,395,470 S139P possibly damaging Het
Ydjc G A 16: 17,147,799 V143M probably damaging Het
Zfp169 T C 13: 48,498,854 E29G probably benign Het
Zfp292 A G 4: 34,808,935 S1370P probably damaging Het
Zfp763 C T 17: 33,019,617 D185N probably damaging Het
Zfp827 A T 8: 79,060,573 N123Y probably damaging Het
Zfp979 A T 4: 147,613,985 I89N probably damaging Het
Zfr2 T C 10: 81,244,749 L419P probably damaging Het
Other mutations in Fbxo34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Fbxo34 APN 14 47529474 missense probably damaging 0.97
IGL01337:Fbxo34 APN 14 47530217 missense probably benign 0.05
IGL01418:Fbxo34 APN 14 47530784 missense possibly damaging 0.46
IGL02069:Fbxo34 APN 14 47529613 missense probably damaging 1.00
IGL02829:Fbxo34 APN 14 47529689 missense probably benign 0.00
R0601:Fbxo34 UTSW 14 47530257 missense probably benign
R0714:Fbxo34 UTSW 14 47530029 missense probably damaging 1.00
R1186:Fbxo34 UTSW 14 47530586 missense probably damaging 0.99
R1842:Fbxo34 UTSW 14 47531007 missense probably damaging 0.98
R2127:Fbxo34 UTSW 14 47530106 missense probably damaging 0.98
R4199:Fbxo34 UTSW 14 47530997 missense probably damaging 1.00
R4649:Fbxo34 UTSW 14 47529628 missense probably damaging 1.00
R4801:Fbxo34 UTSW 14 47530869 missense probably damaging 1.00
R4802:Fbxo34 UTSW 14 47530869 missense probably damaging 1.00
R4906:Fbxo34 UTSW 14 47529454 missense probably benign 0.26
R5475:Fbxo34 UTSW 14 47529345 missense probably benign 0.01
R5888:Fbxo34 UTSW 14 47529719 missense probably damaging 0.98
R6573:Fbxo34 UTSW 14 47529667 missense possibly damaging 0.61
R7236:Fbxo34 UTSW 14 47530384 missense probably benign 0.00
R7257:Fbxo34 UTSW 14 47500872 critical splice donor site probably null
R7381:Fbxo34 UTSW 14 47530535 missense probably benign 0.02
R7515:Fbxo34 UTSW 14 47530341 missense possibly damaging 0.84
R7562:Fbxo34 UTSW 14 47529678 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCCTGCTTCTGTGCCAAGGTG -3'
(R):5'- GTTTGACAATAGCCCAGGTCCCAG -3'

Sequencing Primer
(F):5'- GCTGTTAGTTCCACAGAAAGTGC -3'
(R):5'- ATTCAAGCTGTTCTCCACAGGG -3'
Posted On2014-05-14