Mutagenetix > Incidental Mutation

Incidental Mutation 'R1714:Apba1'

190907

Institutional Source

Beutler Lab

Gene Symbol

Apba1

Ensembl Gene

ENSMUSG00000024897

Gene Name

amyloid beta (A4) precursor protein binding, family A, member 1

Synonyms

6430513E09Rik, Lin-10, X11, Mint, Mint1, X11alpha

MMRRC Submission

039747-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1714 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

23758876-23949597 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 23944952 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 795 (E795K)

Ref Sequence

ENSEMBL: ENSMUSP00000025830 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025830]

AlphaFold

B2RUJ5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000025830
AA Change: E795K

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000025830
Gene: ENSMUSG00000024897
AA Change: E795K

Domain	Start	End	E-Value	Type
low complexity region	40	47	N/A	INTRINSIC
low complexity region	59	74	N/A	INTRINSIC
low complexity region	129	149	N/A	INTRINSIC
low complexity region	404	421	N/A	INTRINSIC
PTB	461	626	9.49e-33	SMART
PDZ	670	748	3.09e-15	SMART
PDZ	762	828	2.53e-11	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the X11 protein family. It is a neuronal adapter protein that interacts with the Alzheimer's disease amyloid precursor protein (APP). It stabilizes APP and inhibits production of proteolytic APP fragments including the A beta peptide that is deposited in the brains of Alzheimer's disease patients. This gene product is believed to be involved in signal transduction processes. It is also regarded as a putative vesicular trafficking protein in the brain that can form a complex with the potential to couple synaptic vesicle exocytosis to neuronal cell adhesion. [provided by RefSeq, Jul 2008]
PHENOTYPE: Animals carrying a homozygous mutation of this gene have reduced body size. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	C	T	13: 77,316,360	T892I	possibly damaging	Het
Abcb11	A	C	2: 69,306,581	F179V	probably damaging	Het
Adgrg6	G	T	10: 14,439,770	Q597K	possibly damaging	Het
Ankmy1	G	T	1: 92,885,194	Y464*	probably null	Het
Aqp12	T	A	1: 93,006,959	V186D	possibly damaging	Het
Brd8	A	T	18: 34,609,833	S253R	probably damaging	Het
Cdc42se2	A	T	11: 54,740,286	S2R	possibly damaging	Het
Chd9	A	C	8: 91,034,225		probably benign	Het
Clk4	C	T	11: 51,280,418	H219Y	probably damaging	Het
Cngb1	A	G	8: 95,257,931	Y417H	probably damaging	Het
Cr2	A	T	1: 195,151,686	F932I	possibly damaging	Het
Cxxc1	C	A	18: 74,219,863	R415S	probably damaging	Het
Dclk2	G	A	3: 86,906,093	A182V	probably benign	Het
Ddx11	T	G	17: 66,148,759	W718G	probably damaging	Het
Dmd	A	C	X: 83,964,750	T2069P	probably benign	Het
Dnaic1	T	C	4: 41,632,164	F533L	probably benign	Het
Dnajc5b	A	T	3: 19,579,101	R163*	probably null	Het
Dynll2	T	A	11: 87,984,012		probably null	Het
Ercc5	A	G	1: 44,167,339	T471A	probably benign	Het
Fan1	T	C	7: 64,366,687	D563G	probably benign	Het
Fbxo34	A	G	14: 47,529,201	Y6C	probably damaging	Het
Fcrl5	T	A	3: 87,446,406	S353T	probably damaging	Het
Gabrb3	A	T	7: 57,765,428	Y82F	probably damaging	Het
Gm20939	C	A	17: 94,875,806	P157T	probably damaging	Het
Haus3	A	T	5: 34,163,697	H468Q	probably benign	Het
Hist1h2ba	T	C	13: 23,933,952	T69A	probably benign	Het
Il20ra	T	C	10: 19,755,828	V259A	probably damaging	Het
Isg15	A	T	4: 156,199,957	V38E	probably damaging	Het
Kcnq3	A	G	15: 66,000,063	S586P	probably benign	Het
Kl	A	T	5: 150,953,333	Y206F	probably benign	Het
Klk1b24	C	A	7: 44,191,515	D122E	probably damaging	Het
Kmt2d	A	C	15: 98,862,950	S840A	unknown	Het
Krt34	A	G	11: 100,040,127	S150P	possibly damaging	Het
Lamc3	A	G	2: 31,940,757	K1502R	probably benign	Het
Letm1	G	T	5: 33,760,884	R306S	possibly damaging	Het
Lnx1	C	T	5: 74,607,737	G397S	probably null	Het
Lrrc8c	A	G	5: 105,607,291	T311A	possibly damaging	Het
Mpeg1	A	T	19: 12,462,834	D552V	probably damaging	Het
Myh11	C	T	16: 14,236,368		probably null	Het
Ndufa9	T	C	6: 126,822,191		probably null	Het
Olfr1289	A	T	2: 111,483,663	I78F	probably damaging	Het
Olfr1507	A	C	14: 52,490,414		probably null	Het
Olfr281	G	A	15: 98,456,733	C141Y	probably damaging	Het
Polr3d	A	C	14: 70,441,315	M117R	possibly damaging	Het
Ppp5c	T	C	7: 17,008,703	I237V	probably benign	Het
Prrc2c	G	A	1: 162,677,376	T2632M	probably damaging	Het
Ptprg	C	A	14: 12,213,697	Q1022K	probably damaging	Het
Pus10	T	A	11: 23,725,542	H471Q	probably damaging	Het
Ralgapa1	A	G	12: 55,642,389	V1928A	probably damaging	Het
Rbpms2	CACT	CACTACT	9: 65,651,665		probably benign	Het
Rbpms2	ACTGCTGCTGCTGCTGC	ACTGCTGCTGCTGCTGCTGC	9: 65,651,666		probably benign	Het
Rfpl4	T	G	7: 5,110,358	T269P	probably benign	Het
Rgs10	A	G	7: 128,403,222	V72A	probably damaging	Het
Rsph1	T	C	17: 31,255,216	N289S	probably benign	Het
Sbk2	T	C	7: 4,963,122	D21G	probably benign	Het
Shbg	A	T	11: 69,617,157	D127E	possibly damaging	Het
Spag16	A	G	1: 69,843,005	E52G	probably damaging	Het
Ssh2	G	A	11: 77,454,024	G945D	possibly damaging	Het
Sstr3	A	T	15: 78,540,273	D91E	probably damaging	Het
Syne2	C	A	12: 76,054,939	A669E	probably benign	Het
Traf3	A	G	12: 111,242,473	I109V	probably benign	Het
Ube2j1	A	G	4: 33,049,886	T295A	probably damaging	Het
Usp46	A	G	5: 74,003,167	V276A	probably benign	Het
Vmn1r200	T	C	13: 22,395,470	S139P	possibly damaging	Het
Ydjc	G	A	16: 17,147,799	V143M	probably damaging	Het
Zfp169	T	C	13: 48,498,854	E29G	probably benign	Het
Zfp292	A	G	4: 34,808,935	S1370P	probably damaging	Het
Zfp763	C	T	17: 33,019,617	D185N	probably damaging	Het
Zfp827	A	T	8: 79,060,573	N123Y	probably damaging	Het
Zfp979	A	T	4: 147,613,985	I89N	probably damaging	Het
Zfr2	T	C	10: 81,244,749	L419P	probably damaging	Het

Other mutations in Apba1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01475:Apba1	APN	19	23917586	missense	possibly damaging	0.95
IGL01991:Apba1	APN	19	23937472	missense	possibly damaging	0.80
IGL02048:Apba1	APN	19	23937636	splice site	probably null
IGL02522:Apba1	APN	19	23912445	splice site	probably benign
IGL02728:Apba1	APN	19	23944905	missense	possibly damaging	0.93
IGL02942:Apba1	APN	19	23944971	missense	possibly damaging	0.78
IGL03349:Apba1	APN	19	23917575	missense	probably benign	0.02
IGL03410:Apba1	APN	19	23937581	missense	possibly damaging	0.67
R0052:Apba1	UTSW	19	23915951	missense	possibly damaging	0.90
R0052:Apba1	UTSW	19	23915951	missense	possibly damaging	0.90
R0084:Apba1	UTSW	19	23912497	missense	possibly damaging	0.68
R0379:Apba1	UTSW	19	23934830	missense	probably damaging	1.00
R0423:Apba1	UTSW	19	23944998	missense	probably damaging	1.00
R1132:Apba1	UTSW	19	23917553	missense	possibly damaging	0.83
R1291:Apba1	UTSW	19	23917672	missense	probably damaging	0.97
R1681:Apba1	UTSW	19	23936561	missense	probably damaging	1.00
R1756:Apba1	UTSW	19	23893692	missense	possibly damaging	0.83
R1866:Apba1	UTSW	19	23892831	missense	probably benign	0.22
R2076:Apba1	UTSW	19	23893223	nonsense	probably null
R2217:Apba1	UTSW	19	23893962	missense	probably damaging	0.99
R3907:Apba1	UTSW	19	23937506	missense	probably damaging	0.96
R4095:Apba1	UTSW	19	23944024	missense	probably benign	0.00
R4529:Apba1	UTSW	19	23936535	missense	probably damaging	1.00
R4557:Apba1	UTSW	19	23917592	missense	probably damaging	1.00
R4972:Apba1	UTSW	19	23912536	missense	probably benign	0.24
R5521:Apba1	UTSW	19	23893593	missense	probably damaging	1.00
R6539:Apba1	UTSW	19	23936560	missense	probably damaging	1.00
R7032:Apba1	UTSW	19	23912461	missense	probably benign	0.20
R7035:Apba1	UTSW	19	23917567	missense	possibly damaging	0.88
R7495:Apba1	UTSW	19	23936599	critical splice donor site	probably null
R9149:Apba1	UTSW	19	23893418	missense	probably damaging	1.00
R9288:Apba1	UTSW	19	23945781	makesense	probably null
Z1176:Apba1	UTSW	19	23944115	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTGGTCAGAGTTCAGGACACTAGG -3'
(R):5'- AAGGTTCCCAGCGAGGCTAGAATG -3'

Sequencing Primer
(F):5'- ggatcagacacagaatctgtcac -3'
(R):5'- CTAGAATGGCACTAGGGGC -3'

Posted On

2014-05-14