Incidental Mutation 'R1715:Olfr361'
ID190911
Institutional Source Beutler Lab
Gene Symbol Olfr361
Ensembl Gene ENSMUSG00000075378
Gene Nameolfactory receptor 361
SynonymsGA_x6K02T2NLDC-33777519-33776551, MOR159-3
MMRRC Submission 039748-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R1715 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location37083736-37089290 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 37085176 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 191 (P191S)
Ref Sequence ENSEMBL: ENSMUSP00000149770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100145] [ENSMUST00000214969] [ENSMUST00000216663]
Predicted Effect probably damaging
Transcript: ENSMUST00000100145
AA Change: P191S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000097723
Gene: ENSMUSG00000075378
AA Change: P191S

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.5e-44 PFAM
Pfam:7tm_1 41 289 2.3e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122434
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126779
Predicted Effect probably damaging
Transcript: ENSMUST00000214969
AA Change: P191S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000216663
AA Change: P191S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700023F06Rik T C 11: 103,199,824 probably null Het
2210010C04Rik A G 6: 41,032,936 probably null Het
2410089E03Rik T A 15: 8,226,900 probably null Het
Abca8a G A 11: 110,091,580 T12M probably damaging Het
Alms1 T A 6: 85,629,052 Y2561* probably null Het
Atp10a G A 7: 58,786,505 V348I probably damaging Het
Best2 T C 8: 85,011,223 Y181C probably benign Het
Btaf1 T A 19: 36,969,121 D442E probably damaging Het
C330027C09Rik C T 16: 49,005,719 T383I probably benign Het
Carmil3 T G 14: 55,504,532 V1153G probably benign Het
Cc2d2a A G 5: 43,718,661 I993M probably damaging Het
Ccng1 G A 11: 40,752,114 P169S probably benign Het
Cmtr2 T C 8: 110,222,798 L580P probably damaging Het
Col22a1 T C 15: 72,006,981 E109G possibly damaging Het
Crispld2 G T 8: 120,023,649 W264L possibly damaging Het
Cyp2c38 T C 19: 39,404,795 H276R probably benign Het
Dag1 A T 9: 108,208,715 V409E possibly damaging Het
Emc8 T C 8: 120,658,555 N146S probably benign Het
Glt8d1 T C 14: 31,011,521 V321A possibly damaging Het
Gm5174 C T 10: 86,656,912 noncoding transcript Het
Hdac10 G T 15: 89,126,709 probably null Het
Hectd4 A G 5: 121,344,818 D3144G possibly damaging Het
Ifna11 C T 4: 88,820,236 S93L probably damaging Het
Il16 T C 7: 83,648,728 N431S probably benign Het
Irf8 A T 8: 120,754,388 E237V probably damaging Het
Lrp1b A G 2: 41,185,981 Y1769H probably damaging Het
Lrrc9 A G 12: 72,477,299 N761D probably damaging Het
Mbtps1 T C 8: 119,542,730 Y207C probably benign Het
Myo9a A G 9: 59,832,300 E765G probably damaging Het
Nlrp3 A G 11: 59,543,351 D80G probably damaging Het
Olfr697 G C 7: 106,741,548 P129A probably damaging Het
Olfr830 A T 9: 18,875,794 I156F probably benign Het
Pcyt2 T A 11: 120,615,851 probably null Het
Plxnd1 T C 6: 115,968,681 T944A probably benign Het
Psd4 A T 2: 24,405,332 I833F probably damaging Het
Psmd7 A G 8: 107,581,185 I222T probably benign Het
Rap2b A G 3: 61,365,190 E45G probably damaging Het
Rbm22 T C 18: 60,560,844 S7P possibly damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Rfx4 A G 10: 84,844,280 N107S probably damaging Het
Ripk2 T A 4: 16,155,192 probably null Het
Rpgrip1 T A 14: 52,140,691 C499S possibly damaging Het
Scarf1 T C 11: 75,524,044 S515P probably damaging Het
Sgip1 T C 4: 102,915,059 V215A probably benign Het
Sis T C 3: 72,889,010 I1813V possibly damaging Het
Slc17a3 A T 13: 23,856,741 T317S probably benign Het
Slc35e1 T C 8: 72,483,977 N340S probably benign Het
Smg6 A G 11: 74,929,430 I176V probably benign Het
Smim17 T C 7: 6,429,326 L89S probably damaging Het
Synm T C 7: 67,736,303 N95S probably damaging Het
Tdrd9 A G 12: 112,036,439 K841E possibly damaging Het
Tep1 G T 14: 50,854,567 F570L possibly damaging Het
Tgm3 G A 2: 130,026,814 probably null Het
Tra2b T C 16: 22,252,746 Y128C possibly damaging Het
Vmn2r17 T C 5: 109,428,244 V327A probably benign Het
Wdr20rt A T 12: 65,227,314 D344V probably damaging Het
Zfp940 A G 7: 29,844,938 C515R probably damaging Het
Other mutations in Olfr361
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01531:Olfr361 APN 2 37085395 missense possibly damaging 0.94
IGL02210:Olfr361 APN 2 37085619 missense possibly damaging 0.54
IGL03180:Olfr361 APN 2 37085710 missense possibly damaging 0.58
R0571:Olfr361 UTSW 2 37085334 missense probably benign 0.00
R1853:Olfr361 UTSW 2 37085220 missense probably damaging 1.00
R2403:Olfr361 UTSW 2 37084974 missense probably benign 0.34
R3009:Olfr361 UTSW 2 37085077 missense probably benign 0.00
R3713:Olfr361 UTSW 2 37085505 missense possibly damaging 0.73
R4355:Olfr361 UTSW 2 37084930 missense probably benign 0.44
R4476:Olfr361 UTSW 2 37085061 missense probably damaging 1.00
R5191:Olfr361 UTSW 2 37084978 missense probably benign 0.00
R5387:Olfr361 UTSW 2 37085719 missense possibly damaging 0.58
R5529:Olfr361 UTSW 2 37084909 missense possibly damaging 0.67
R5891:Olfr361 UTSW 2 37084978 missense probably benign 0.00
R7078:Olfr361 UTSW 2 37085596 missense possibly damaging 0.93
R7208:Olfr361 UTSW 2 37085658 missense probably benign 0.26
R7793:Olfr361 UTSW 2 37084921 missense possibly damaging 0.81
R8007:Olfr361 UTSW 2 37084843 missense probably damaging 1.00
Z1176:Olfr361 UTSW 2 37085636 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCCTTGCCTCTCAGGAGATTCAC -3'
(R):5'- GCCATAGCCTCTGTCTGCGAATAAC -3'

Sequencing Primer
(F):5'- GGACACTGCCTGAGATATAGTTTCC -3'
(R):5'- CTGTCTGCGAATAACATTGACC -3'
Posted On2014-05-14