Incidental Mutation 'R1715:Rap2b'
ID190914
Institutional Source Beutler Lab
Gene Symbol Rap2b
Ensembl Gene ENSMUSG00000036894
Gene NameRAP2B, member of RAS oncogene family
Synonyms4021402C18Rik
MMRRC Submission 039748-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R1715 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location61361638-61368430 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 61365190 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 45 (E45G)
Ref Sequence ENSEMBL: ENSMUSP00000038841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049064] [ENSMUST00000066298]
Predicted Effect probably damaging
Transcript: ENSMUST00000049064
AA Change: E45G

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000038841
Gene: ENSMUSG00000036894
AA Change: E45G

DomainStartEndE-ValueType
RAS 1 167 3.08e-111 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000066298
SMART Domains Protein: ENSMUSP00000070175
Gene: ENSMUSG00000053706

DomainStartEndE-ValueType
low complexity region 95 103 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194223
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene belongs to a family of RAS-related genes. The proteins encoded by these genes share approximately 50% amino acid identity with the classical RAS proteins and have numerous structural features in common. The most striking difference between the RAP and RAS proteins resides in their 61st amino acid: glutamine in RAS is replaced by threonine in RAP proteins. Evidence suggests that this protein may be polyisoprenylated and palmitoylated. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700023F06Rik T C 11: 103,199,824 probably null Het
2210010C04Rik A G 6: 41,032,936 probably null Het
2410089E03Rik T A 15: 8,226,900 probably null Het
Abca8a G A 11: 110,091,580 T12M probably damaging Het
Alms1 T A 6: 85,629,052 Y2561* probably null Het
Atp10a G A 7: 58,786,505 V348I probably damaging Het
Best2 T C 8: 85,011,223 Y181C probably benign Het
Btaf1 T A 19: 36,969,121 D442E probably damaging Het
C330027C09Rik C T 16: 49,005,719 T383I probably benign Het
Carmil3 T G 14: 55,504,532 V1153G probably benign Het
Cc2d2a A G 5: 43,718,661 I993M probably damaging Het
Ccng1 G A 11: 40,752,114 P169S probably benign Het
Cmtr2 T C 8: 110,222,798 L580P probably damaging Het
Col22a1 T C 15: 72,006,981 E109G possibly damaging Het
Crispld2 G T 8: 120,023,649 W264L possibly damaging Het
Cyp2c38 T C 19: 39,404,795 H276R probably benign Het
Dag1 A T 9: 108,208,715 V409E possibly damaging Het
Emc8 T C 8: 120,658,555 N146S probably benign Het
Glt8d1 T C 14: 31,011,521 V321A possibly damaging Het
Gm5174 C T 10: 86,656,912 noncoding transcript Het
Hdac10 G T 15: 89,126,709 probably null Het
Hectd4 A G 5: 121,344,818 D3144G possibly damaging Het
Ifna11 C T 4: 88,820,236 S93L probably damaging Het
Il16 T C 7: 83,648,728 N431S probably benign Het
Irf8 A T 8: 120,754,388 E237V probably damaging Het
Lrp1b A G 2: 41,185,981 Y1769H probably damaging Het
Lrrc9 A G 12: 72,477,299 N761D probably damaging Het
Mbtps1 T C 8: 119,542,730 Y207C probably benign Het
Myo9a A G 9: 59,832,300 E765G probably damaging Het
Nlrp3 A G 11: 59,543,351 D80G probably damaging Het
Olfr361 G A 2: 37,085,176 P191S probably damaging Het
Olfr697 G C 7: 106,741,548 P129A probably damaging Het
Olfr830 A T 9: 18,875,794 I156F probably benign Het
Pcyt2 T A 11: 120,615,851 probably null Het
Plxnd1 T C 6: 115,968,681 T944A probably benign Het
Psd4 A T 2: 24,405,332 I833F probably damaging Het
Psmd7 A G 8: 107,581,185 I222T probably benign Het
Rbm22 T C 18: 60,560,844 S7P possibly damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Rfx4 A G 10: 84,844,280 N107S probably damaging Het
Ripk2 T A 4: 16,155,192 probably null Het
Rpgrip1 T A 14: 52,140,691 C499S possibly damaging Het
Scarf1 T C 11: 75,524,044 S515P probably damaging Het
Sgip1 T C 4: 102,915,059 V215A probably benign Het
Sis T C 3: 72,889,010 I1813V possibly damaging Het
Slc17a3 A T 13: 23,856,741 T317S probably benign Het
Slc35e1 T C 8: 72,483,977 N340S probably benign Het
Smg6 A G 11: 74,929,430 I176V probably benign Het
Smim17 T C 7: 6,429,326 L89S probably damaging Het
Synm T C 7: 67,736,303 N95S probably damaging Het
Tdrd9 A G 12: 112,036,439 K841E possibly damaging Het
Tep1 G T 14: 50,854,567 F570L possibly damaging Het
Tgm3 G A 2: 130,026,814 probably null Het
Tra2b T C 16: 22,252,746 Y128C possibly damaging Het
Vmn2r17 T C 5: 109,428,244 V327A probably benign Het
Wdr20rt A T 12: 65,227,314 D344V probably damaging Het
Zfp940 A G 7: 29,844,938 C515R probably damaging Het
Other mutations in Rap2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02544:Rap2b APN 3 61365139 missense probably damaging 1.00
R2117:Rap2b UTSW 3 61365091 missense probably damaging 1.00
R8217:Rap2b UTSW 3 61365130 missense possibly damaging 0.87
R8420:Rap2b UTSW 3 61364384 utr 5 prime probably benign
Predicted Primers PCR Primer
(F):5'- AATTAGCAGCCGCCTCTGCAAC -3'
(R):5'- TTGCCTACCAGGATCATGGGTACG -3'

Sequencing Primer
(F):5'- TTCCTGCGAAGTTGAGGAAG -3'
(R):5'- ATCATGGGTACGCGCTC -3'
Posted On2014-05-14