Incidental Mutation 'R1715:Ripk2'
ID190916
Institutional Source Beutler Lab
Gene Symbol Ripk2
Ensembl Gene ENSMUSG00000041135
Gene Namereceptor (TNFRSF)-interacting serine-threonine kinase 2
SynonymsCCK, RICK, CARD3, D4Bwg0615e, 2210420D18Rik, RIP2, CARDIAK
MMRRC Submission 039748-MU
Accession Numbers

Ncbi RefSeq: NM_138952.3; MGI:1891456

Is this an essential gene? Probably non essential (E-score: 0.196) question?
Stock #R1715 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location16122733-16163647 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to A at 16155192 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000038833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037035] [ENSMUST00000183871]
Predicted Effect probably null
Transcript: ENSMUST00000037035
SMART Domains Protein: ENSMUSP00000038833
Gene: ENSMUSG00000041135

DomainStartEndE-ValueType
Pfam:Pkinase 18 289 2.1e-43 PFAM
Pfam:Pkinase_Tyr 18 290 1.1e-45 PFAM
CARD 434 522 2.34e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183871
SMART Domains Protein: ENSMUSP00000139381
Gene: ENSMUSG00000041135

DomainStartEndE-ValueType
Pfam:Pkinase 18 290 5.6e-46 PFAM
Pfam:Pkinase_Tyr 18 290 1.2e-44 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype Strain: 3622328; 2660793;2446070
FUNCTION: This gene encodes a member of the receptor-interacting protein family of serine/threonine protein kinases. The encoded protein contains a C-terminal caspase activation and recruitment domain, and is a component of signaling complexes in both the innate and adaptive immune pathways. It is a potent activator of nuclear factor kappa B and inducer of apoptosis in response to various stimuli. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous inactivation of this gene leads to impaired cytokine production in response to LPS treatment, and may result in resistance to LPS-induced septic shock and defects in Toll-like receptor and T-cell receptor signaling. Macrophages homozygous for a knock-in allele show normal LPS signaling. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(5) Gene trapped(2)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700023F06Rik T C 11: 103,199,824 probably null Het
2210010C04Rik A G 6: 41,032,936 probably null Het
2410089E03Rik T A 15: 8,226,900 probably null Het
Abca8a G A 11: 110,091,580 T12M probably damaging Het
Alms1 T A 6: 85,629,052 Y2561* probably null Het
Atp10a G A 7: 58,786,505 V348I probably damaging Het
Best2 T C 8: 85,011,223 Y181C probably benign Het
Btaf1 T A 19: 36,969,121 D442E probably damaging Het
C330027C09Rik C T 16: 49,005,719 T383I probably benign Het
Carmil3 T G 14: 55,504,532 V1153G probably benign Het
Cc2d2a A G 5: 43,718,661 I993M probably damaging Het
Ccng1 G A 11: 40,752,114 P169S probably benign Het
Cmtr2 T C 8: 110,222,798 L580P probably damaging Het
Col22a1 T C 15: 72,006,981 E109G possibly damaging Het
Crispld2 G T 8: 120,023,649 W264L possibly damaging Het
Cyp2c38 T C 19: 39,404,795 H276R probably benign Het
Dag1 A T 9: 108,208,715 V409E possibly damaging Het
Emc8 T C 8: 120,658,555 N146S probably benign Het
Glt8d1 T C 14: 31,011,521 V321A possibly damaging Het
Gm5174 C T 10: 86,656,912 noncoding transcript Het
Hdac10 G T 15: 89,126,709 probably null Het
Hectd4 A G 5: 121,344,818 D3144G possibly damaging Het
Ifna11 C T 4: 88,820,236 S93L probably damaging Het
Il16 T C 7: 83,648,728 N431S probably benign Het
Irf8 A T 8: 120,754,388 E237V probably damaging Het
Lrp1b A G 2: 41,185,981 Y1769H probably damaging Het
Lrrc9 A G 12: 72,477,299 N761D probably damaging Het
Mbtps1 T C 8: 119,542,730 Y207C probably benign Het
Myo9a A G 9: 59,832,300 E765G probably damaging Het
Nlrp3 A G 11: 59,543,351 D80G probably damaging Het
Olfr361 G A 2: 37,085,176 P191S probably damaging Het
Olfr697 G C 7: 106,741,548 P129A probably damaging Het
Olfr830 A T 9: 18,875,794 I156F probably benign Het
Pcyt2 T A 11: 120,615,851 probably null Het
Plxnd1 T C 6: 115,968,681 T944A probably benign Het
Psd4 A T 2: 24,405,332 I833F probably damaging Het
Psmd7 A G 8: 107,581,185 I222T probably benign Het
Rap2b A G 3: 61,365,190 E45G probably damaging Het
Rbm22 T C 18: 60,560,844 S7P possibly damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Rfx4 A G 10: 84,844,280 N107S probably damaging Het
Rpgrip1 T A 14: 52,140,691 C499S possibly damaging Het
Scarf1 T C 11: 75,524,044 S515P probably damaging Het
Sgip1 T C 4: 102,915,059 V215A probably benign Het
Sis T C 3: 72,889,010 I1813V possibly damaging Het
Slc17a3 A T 13: 23,856,741 T317S probably benign Het
Slc35e1 T C 8: 72,483,977 N340S probably benign Het
Smg6 A G 11: 74,929,430 I176V probably benign Het
Smim17 T C 7: 6,429,326 L89S probably damaging Het
Synm T C 7: 67,736,303 N95S probably damaging Het
Tdrd9 A G 12: 112,036,439 K841E possibly damaging Het
Tep1 G T 14: 50,854,567 F570L possibly damaging Het
Tgm3 G A 2: 130,026,814 probably null Het
Tra2b T C 16: 22,252,746 Y128C possibly damaging Het
Vmn2r17 T C 5: 109,428,244 V327A probably benign Het
Wdr20rt A T 12: 65,227,314 D344V probably damaging Het
Zfp940 A G 7: 29,844,938 C515R probably damaging Het
Other mutations in Ripk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01290:Ripk2 APN 4 16139198 splice site probably benign
IGL01346:Ripk2 APN 4 16132775 critical splice donor site probably null
IGL01631:Ripk2 APN 4 16163342 missense possibly damaging 0.83
IGL02151:Ripk2 APN 4 16139240 missense possibly damaging 0.83
IGL03093:Ripk2 APN 4 16152056 missense probably damaging 1.00
R0066:Ripk2 UTSW 4 16123868 nonsense probably null
R0066:Ripk2 UTSW 4 16123868 nonsense probably null
R0189:Ripk2 UTSW 4 16129125 splice site probably null
R1454:Ripk2 UTSW 4 16163239 missense probably damaging 0.96
R2153:Ripk2 UTSW 4 16132775 critical splice donor site probably null
R2266:Ripk2 UTSW 4 16152011 missense possibly damaging 0.91
R2394:Ripk2 UTSW 4 16132774 splice site probably benign
R3693:Ripk2 UTSW 4 16127695 missense probably benign
R4412:Ripk2 UTSW 4 16124511 missense probably benign
R4463:Ripk2 UTSW 4 16151968 missense possibly damaging 0.70
R4843:Ripk2 UTSW 4 16155073 missense probably damaging 0.99
R5085:Ripk2 UTSW 4 16127663 missense possibly damaging 0.78
R5453:Ripk2 UTSW 4 16151989 missense probably damaging 1.00
R6197:Ripk2 UTSW 4 16163330 missense probably damaging 1.00
R6576:Ripk2 UTSW 4 16131558 splice site probably null
R6967:Ripk2 UTSW 4 16158275 critical splice donor site probably null
R7351:Ripk2 UTSW 4 16155048 missense probably damaging 1.00
R7479:Ripk2 UTSW 4 16155154 missense probably benign 0.02
R7718:Ripk2 UTSW 4 16151968 missense possibly damaging 0.70
R8188:Ripk2 UTSW 4 16139218 missense probably damaging 1.00
R8242:Ripk2 UTSW 4 16124430 missense probably benign 0.00
R8509:Ripk2 UTSW 4 16124436 missense probably benign
Z1176:Ripk2 UTSW 4 16151943 missense probably damaging 1.00
Z1177:Ripk2 UTSW 4 16163331 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- CAATAATAACTGAACTCAAGAAAGGGGCtgaa -3'
(R):5'- TTAAACAGaatggaggagttagaggaagga -3'

Sequencing Primer
(F):5'- tcattccttcacatacccagtc -3'
(R):5'- gaggtgggagtgggtgg -3'
Posted On2014-05-14