Mutagenetix > Incidental Mutations

Incidental Mutation 'R1715:Ripk2'

190916

Institutional Source

Beutler Lab

Gene Symbol

Ripk2

Ensembl Gene

ENSMUSG00000041135

Gene Name

receptor (TNFRSF)-interacting serine-threonine kinase 2

Synonyms

CCK, RICK, CARD3, D4Bwg0615e, 2210420D18Rik, RIP2, CARDIAK

MMRRC Submission

039748-MU

Accession Numbers

Ncbi RefSeq: NM_138952.3; MGI:1891456

Is this an essential gene?

Probably non essential (E-score: 0.196) question?

Stock #

R1715 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

16122733-16163647 bp(-) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

T to A at 16155192 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000038833 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037035] [ENSMUST00000183871]

Predicted Effect

probably null
Transcript: ENSMUST00000037035

SMART Domains

Protein: ENSMUSP00000038833
Gene: ENSMUSG00000041135

Domain	Start	End	E-Value	Type
Pfam:Pkinase	18	289	2.1e-43	PFAM
Pfam:Pkinase_Tyr	18	290	1.1e-45	PFAM
CARD	434	522	2.34e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000183871

SMART Domains

Protein: ENSMUSP00000139381
Gene: ENSMUSG00000041135

Domain	Start	End	E-Value	Type
Pfam:Pkinase	18	290	5.6e-46	PFAM
Pfam:Pkinase_Tyr	18	290	1.2e-44	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.1%

Validation Efficiency

MGI Phenotype

Strain: 3622328; 2660793;2446070
FUNCTION: This gene encodes a member of the receptor-interacting protein family of serine/threonine protein kinases. The encoded protein contains a C-terminal caspase activation and recruitment domain, and is a component of signaling complexes in both the innate and adaptive immune pathways. It is a potent activator of nuclear factor kappa B and inducer of apoptosis in response to various stimuli. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous inactivation of this gene leads to impaired cytokine production in response to LPS treatment, and may result in resistance to LPS-induced septic shock and defects in Toll-like receptor and T-cell receptor signaling. Macrophages homozygous for a knock-in allele show normal LPS signaling. [provided by MGI curators]

Allele List at MGI

All alleles(7) : Targeted(5) Gene trapped(2)

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700023F06Rik	T	C	11: 103,199,824		probably null	Het
2210010C04Rik	A	G	6: 41,032,936		probably null	Het
2410089E03Rik	T	A	15: 8,226,900		probably null	Het
Abca8a	G	A	11: 110,091,580	T12M	probably damaging	Het
Alms1	T	A	6: 85,629,052	Y2561*	probably null	Het
Atp10a	G	A	7: 58,786,505	V348I	probably damaging	Het
Best2	T	C	8: 85,011,223	Y181C	probably benign	Het
Btaf1	T	A	19: 36,969,121	D442E	probably damaging	Het
C330027C09Rik	C	T	16: 49,005,719	T383I	probably benign	Het
Carmil3	T	G	14: 55,504,532	V1153G	probably benign	Het
Cc2d2a	A	G	5: 43,718,661	I993M	probably damaging	Het
Ccng1	G	A	11: 40,752,114	P169S	probably benign	Het
Cmtr2	T	C	8: 110,222,798	L580P	probably damaging	Het
Col22a1	T	C	15: 72,006,981	E109G	possibly damaging	Het
Crispld2	G	T	8: 120,023,649	W264L	possibly damaging	Het
Cyp2c38	T	C	19: 39,404,795	H276R	probably benign	Het
Dag1	A	T	9: 108,208,715	V409E	possibly damaging	Het
Emc8	T	C	8: 120,658,555	N146S	probably benign	Het
Glt8d1	T	C	14: 31,011,521	V321A	possibly damaging	Het
Gm5174	C	T	10: 86,656,912		noncoding transcript	Het
Hdac10	G	T	15: 89,126,709		probably null	Het
Hectd4	A	G	5: 121,344,818	D3144G	possibly damaging	Het
Ifna11	C	T	4: 88,820,236	S93L	probably damaging	Het
Il16	T	C	7: 83,648,728	N431S	probably benign	Het
Irf8	A	T	8: 120,754,388	E237V	probably damaging	Het
Lrp1b	A	G	2: 41,185,981	Y1769H	probably damaging	Het
Lrrc9	A	G	12: 72,477,299	N761D	probably damaging	Het
Mbtps1	T	C	8: 119,542,730	Y207C	probably benign	Het
Myo9a	A	G	9: 59,832,300	E765G	probably damaging	Het
Nlrp3	A	G	11: 59,543,351	D80G	probably damaging	Het
Olfr361	G	A	2: 37,085,176	P191S	probably damaging	Het
Olfr697	G	C	7: 106,741,548	P129A	probably damaging	Het
Olfr830	A	T	9: 18,875,794	I156F	probably benign	Het
Pcyt2	T	A	11: 120,615,851		probably null	Het
Plxnd1	T	C	6: 115,968,681	T944A	probably benign	Het
Psd4	A	T	2: 24,405,332	I833F	probably damaging	Het
Psmd7	A	G	8: 107,581,185	I222T	probably benign	Het
Rap2b	A	G	3: 61,365,190	E45G	probably damaging	Het
Rbm22	T	C	18: 60,560,844	S7P	possibly damaging	Het
Rbpms2	ACTGCTGCTGCTGCTGC	ACTGCTGCTGCTGCTGCTGC	9: 65,651,666		probably benign	Het
Rfx4	A	G	10: 84,844,280	N107S	probably damaging	Het
Rpgrip1	T	A	14: 52,140,691	C499S	possibly damaging	Het
Scarf1	T	C	11: 75,524,044	S515P	probably damaging	Het
Sgip1	T	C	4: 102,915,059	V215A	probably benign	Het
Sis	T	C	3: 72,889,010	I1813V	possibly damaging	Het
Slc17a3	A	T	13: 23,856,741	T317S	probably benign	Het
Slc35e1	T	C	8: 72,483,977	N340S	probably benign	Het
Smg6	A	G	11: 74,929,430	I176V	probably benign	Het
Smim17	T	C	7: 6,429,326	L89S	probably damaging	Het
Synm	T	C	7: 67,736,303	N95S	probably damaging	Het
Tdrd9	A	G	12: 112,036,439	K841E	possibly damaging	Het
Tep1	G	T	14: 50,854,567	F570L	possibly damaging	Het
Tgm3	G	A	2: 130,026,814		probably null	Het
Tra2b	T	C	16: 22,252,746	Y128C	possibly damaging	Het
Vmn2r17	T	C	5: 109,428,244	V327A	probably benign	Het
Wdr20rt	A	T	12: 65,227,314	D344V	probably damaging	Het
Zfp940	A	G	7: 29,844,938	C515R	probably damaging	Het

Other mutations in Ripk2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01290:Ripk2	APN	4	16139198	splice site	probably benign
IGL01346:Ripk2	APN	4	16132775	critical splice donor site	probably null
IGL01631:Ripk2	APN	4	16163342	missense	possibly damaging	0.83
IGL02151:Ripk2	APN	4	16139240	missense	possibly damaging	0.83
IGL03093:Ripk2	APN	4	16152056	missense	probably damaging	1.00
R0066:Ripk2	UTSW	4	16123868	nonsense	probably null
R0066:Ripk2	UTSW	4	16123868	nonsense	probably null
R0189:Ripk2	UTSW	4	16129125	splice site	probably null
R1454:Ripk2	UTSW	4	16163239	missense	probably damaging	0.96
R2153:Ripk2	UTSW	4	16132775	critical splice donor site	probably null
R2266:Ripk2	UTSW	4	16152011	missense	possibly damaging	0.91
R2394:Ripk2	UTSW	4	16132774	splice site	probably benign
R3693:Ripk2	UTSW	4	16127695	missense	probably benign
R4412:Ripk2	UTSW	4	16124511	missense	probably benign
R4463:Ripk2	UTSW	4	16151968	missense	possibly damaging	0.70
R4843:Ripk2	UTSW	4	16155073	missense	probably damaging	0.99
R5085:Ripk2	UTSW	4	16127663	missense	possibly damaging	0.78
R5453:Ripk2	UTSW	4	16151989	missense	probably damaging	1.00
R6197:Ripk2	UTSW	4	16163330	missense	probably damaging	1.00
R6576:Ripk2	UTSW	4	16131558	splice site	probably null
R6967:Ripk2	UTSW	4	16158275	critical splice donor site	probably null
R7351:Ripk2	UTSW	4	16155048	missense	probably damaging	1.00
R7479:Ripk2	UTSW	4	16155154	missense	probably benign	0.02
R7718:Ripk2	UTSW	4	16151968	missense	possibly damaging	0.70
R8188:Ripk2	UTSW	4	16139218	missense	probably damaging	1.00
R8242:Ripk2	UTSW	4	16124430	missense	probably benign	0.00
R8509:Ripk2	UTSW	4	16124436	missense	probably benign
Z1176:Ripk2	UTSW	4	16151943	missense	probably damaging	1.00
Z1177:Ripk2	UTSW	4	16163331	missense	probably benign	0.21

Predicted Primers

PCR Primer
(F):5'- CAATAATAACTGAACTCAAGAAAGGGGCtgaa -3'
(R):5'- TTAAACAGaatggaggagttagaggaagga -3'

Sequencing Primer
(F):5'- tcattccttcacatacccagtc -3'
(R):5'- gaggtgggagtgggtgg -3'

Posted On

2014-05-14