Incidental Mutation 'R1715:Alms1'
Institutional Source Beutler Lab
Gene Symbol Alms1
Ensembl Gene ENSMUSG00000063810
Gene NameALMS1, centrosome and basal body associated
MMRRC Submission 039748-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1715 (G1)
Quality Score225
Status Not validated
Chromosomal Location85587531-85702753 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 85629052 bp
Amino Acid Change Tyrosine to Stop codon at position 2561 (Y2561*)
Ref Sequence ENSEMBL: ENSMUSP00000148796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072018] [ENSMUST00000213058]
Predicted Effect probably null
Transcript: ENSMUST00000072018
AA Change: Y2092*
SMART Domains Protein: ENSMUSP00000071904
Gene: ENSMUSG00000063810
AA Change: Y2092*

coiled coil region 10 39 N/A INTRINSIC
low complexity region 67 80 N/A INTRINSIC
low complexity region 98 119 N/A INTRINSIC
Blast:MYSc 127 233 1e-21 BLAST
internal_repeat_3 408 511 2.48e-7 PROSPERO
internal_repeat_2 414 804 2.09e-12 PROSPERO
internal_repeat_1 438 834 4.54e-18 PROSPERO
internal_repeat_3 652 757 2.48e-7 PROSPERO
low complexity region 903 908 N/A INTRINSIC
internal_repeat_1 916 1385 4.54e-18 PROSPERO
internal_repeat_2 1024 1390 2.09e-12 PROSPERO
low complexity region 1572 1586 N/A INTRINSIC
low complexity region 2004 2017 N/A INTRINSIC
low complexity region 2760 2773 N/A INTRINSIC
low complexity region 2950 2968 N/A INTRINSIC
low complexity region 3013 3030 N/A INTRINSIC
Pfam:ALMS_motif 3125 3247 1.8e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201862
Predicted Effect probably null
Transcript: ENSMUST00000213058
AA Change: Y2561*
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a large tandem-repeat domain as well as additional low complexity regions. The encoded protein functions in microtubule organization, particularly in the formation and maintanance of cilia. Mutations in this gene cause Alstrom syndrome. There is a pseudogene for this gene located adjacent in the same region of chromosome 2. Alternative splice variants have been described but their full length nature has not been determined. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygous null mice display obesity starting after puberty, hypogonadism, hyperinsulinemia, male-specific hyperglycemia, retinal dysfunction, and late-onset hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700023F06Rik T C 11: 103,199,824 probably null Het
2210010C04Rik A G 6: 41,032,936 probably null Het
2410089E03Rik T A 15: 8,226,900 probably null Het
Abca8a G A 11: 110,091,580 T12M probably damaging Het
Atp10a G A 7: 58,786,505 V348I probably damaging Het
Best2 T C 8: 85,011,223 Y181C probably benign Het
Btaf1 T A 19: 36,969,121 D442E probably damaging Het
C330027C09Rik C T 16: 49,005,719 T383I probably benign Het
Carmil3 T G 14: 55,504,532 V1153G probably benign Het
Cc2d2a A G 5: 43,718,661 I993M probably damaging Het
Ccng1 G A 11: 40,752,114 P169S probably benign Het
Cmtr2 T C 8: 110,222,798 L580P probably damaging Het
Col22a1 T C 15: 72,006,981 E109G possibly damaging Het
Crispld2 G T 8: 120,023,649 W264L possibly damaging Het
Cyp2c38 T C 19: 39,404,795 H276R probably benign Het
Dag1 A T 9: 108,208,715 V409E possibly damaging Het
Emc8 T C 8: 120,658,555 N146S probably benign Het
Glt8d1 T C 14: 31,011,521 V321A possibly damaging Het
Gm5174 C T 10: 86,656,912 noncoding transcript Het
Hdac10 G T 15: 89,126,709 probably null Het
Hectd4 A G 5: 121,344,818 D3144G possibly damaging Het
Ifna11 C T 4: 88,820,236 S93L probably damaging Het
Il16 T C 7: 83,648,728 N431S probably benign Het
Irf8 A T 8: 120,754,388 E237V probably damaging Het
Lrp1b A G 2: 41,185,981 Y1769H probably damaging Het
Lrrc9 A G 12: 72,477,299 N761D probably damaging Het
Mbtps1 T C 8: 119,542,730 Y207C probably benign Het
Myo9a A G 9: 59,832,300 E765G probably damaging Het
Nlrp3 A G 11: 59,543,351 D80G probably damaging Het
Olfr361 G A 2: 37,085,176 P191S probably damaging Het
Olfr697 G C 7: 106,741,548 P129A probably damaging Het
Olfr830 A T 9: 18,875,794 I156F probably benign Het
Pcyt2 T A 11: 120,615,851 probably null Het
Plxnd1 T C 6: 115,968,681 T944A probably benign Het
Psd4 A T 2: 24,405,332 I833F probably damaging Het
Psmd7 A G 8: 107,581,185 I222T probably benign Het
Rap2b A G 3: 61,365,190 E45G probably damaging Het
Rbm22 T C 18: 60,560,844 S7P possibly damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Rfx4 A G 10: 84,844,280 N107S probably damaging Het
Ripk2 T A 4: 16,155,192 probably null Het
Rpgrip1 T A 14: 52,140,691 C499S possibly damaging Het
Scarf1 T C 11: 75,524,044 S515P probably damaging Het
Sgip1 T C 4: 102,915,059 V215A probably benign Het
Sis T C 3: 72,889,010 I1813V possibly damaging Het
Slc17a3 A T 13: 23,856,741 T317S probably benign Het
Slc35e1 T C 8: 72,483,977 N340S probably benign Het
Smg6 A G 11: 74,929,430 I176V probably benign Het
Smim17 T C 7: 6,429,326 L89S probably damaging Het
Synm T C 7: 67,736,303 N95S probably damaging Het
Tdrd9 A G 12: 112,036,439 K841E possibly damaging Het
Tep1 G T 14: 50,854,567 F570L possibly damaging Het
Tgm3 G A 2: 130,026,814 probably null Het
Tra2b T C 16: 22,252,746 Y128C possibly damaging Het
Vmn2r17 T C 5: 109,428,244 V327A probably benign Het
Wdr20rt A T 12: 65,227,314 D344V probably damaging Het
Zfp940 A G 7: 29,844,938 C515R probably damaging Het
Other mutations in Alms1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Alms1 APN 6 85677964 missense probably damaging 1.00
IGL00331:Alms1 APN 6 85641371 missense possibly damaging 0.94
IGL00658:Alms1 APN 6 85628961 missense probably damaging 1.00
IGL00835:Alms1 APN 6 85622134 missense probably damaging 1.00
IGL00930:Alms1 APN 6 85601310 missense probably damaging 0.98
IGL01446:Alms1 APN 6 85696701 missense probably damaging 1.00
IGL01448:Alms1 APN 6 85677899 missense possibly damaging 0.93
IGL01563:Alms1 APN 6 85627983 missense probably damaging 1.00
IGL01632:Alms1 APN 6 85627946 missense probably benign 0.07
IGL01651:Alms1 APN 6 85656476 missense probably benign 0.05
IGL01670:Alms1 APN 6 85678150 missense probably benign 0.00
IGL01716:Alms1 APN 6 85628094 missense probably benign 0.01
IGL01719:Alms1 APN 6 85628094 missense probably benign 0.01
IGL01720:Alms1 APN 6 85628094 missense probably benign 0.01
IGL01723:Alms1 APN 6 85628094 missense probably benign 0.01
IGL01877:Alms1 APN 6 85622411 missense possibly damaging 0.55
IGL01919:Alms1 APN 6 85628004 missense possibly damaging 0.77
IGL01976:Alms1 APN 6 85622665 missense possibly damaging 0.73
IGL02003:Alms1 APN 6 85622223 missense possibly damaging 0.54
IGL02069:Alms1 APN 6 85628823 missense probably benign 0.12
IGL02070:Alms1 APN 6 85651403 missense possibly damaging 0.74
IGL02079:Alms1 APN 6 85628634 missense probably damaging 0.98
IGL02081:Alms1 APN 6 85620303 missense possibly damaging 0.55
IGL02379:Alms1 APN 6 85629633 missense probably damaging 0.98
IGL02412:Alms1 APN 6 85628872 missense possibly damaging 0.91
IGL02606:Alms1 APN 6 85599967 missense probably benign
IGL02636:Alms1 APN 6 85628654 missense probably benign 0.28
IGL02702:Alms1 APN 6 85599849 missense probably benign 0.12
IGL02815:Alms1 APN 6 85667957 critical splice donor site probably null
IGL02926:Alms1 APN 6 85641450 missense probably damaging 1.00
IGL02945:Alms1 APN 6 85620933 missense probably damaging 0.96
IGL02959:Alms1 APN 6 85629052 nonsense probably null
IGL03124:Alms1 APN 6 85678419 missense probably benign 0.03
IGL03199:Alms1 APN 6 85622497 missense possibly damaging 0.68
IGL03209:Alms1 APN 6 85599973 splice site probably benign
IGL03247:Alms1 APN 6 85678597 missense possibly damaging 0.85
ares UTSW 6 85621275 nonsense probably null
ares2 UTSW 6 85677990 nonsense probably null
butterball UTSW 6 85696771 missense probably damaging 0.99
earthquake UTSW 6 85628735 nonsense probably null
fatty UTSW 6 85627934 nonsense probably null
gut_check UTSW 6 85620369 nonsense probably null
portly UTSW 6 85619712 missense probably benign 0.00
replete UTSW 6 85629208 missense possibly damaging 0.87
PIT4468001:Alms1 UTSW 6 85624719 critical splice donor site probably null
R0003:Alms1 UTSW 6 85629210 missense possibly damaging 0.90
R0095:Alms1 UTSW 6 85620253 missense possibly damaging 0.90
R0110:Alms1 UTSW 6 85620369 nonsense probably null
R0114:Alms1 UTSW 6 85619803 missense probably benign 0.00
R0153:Alms1 UTSW 6 85641381 missense possibly damaging 0.94
R0217:Alms1 UTSW 6 85622930 missense probably damaging 0.99
R0328:Alms1 UTSW 6 85610814 splice site probably null
R0410:Alms1 UTSW 6 85587803 missense unknown
R0469:Alms1 UTSW 6 85620369 nonsense probably null
R0491:Alms1 UTSW 6 85702600 missense probably damaging 0.98
R0510:Alms1 UTSW 6 85620369 nonsense probably null
R0522:Alms1 UTSW 6 85621615 missense probably benign
R0525:Alms1 UTSW 6 85587760 missense unknown
R0611:Alms1 UTSW 6 85678671 missense possibly damaging 0.61
R0637:Alms1 UTSW 6 85623033 missense possibly damaging 0.85
R0718:Alms1 UTSW 6 85621821 missense probably benign 0.00
R0831:Alms1 UTSW 6 85628520 missense probably benign 0.00
R1318:Alms1 UTSW 6 85628549 missense possibly damaging 0.62
R1340:Alms1 UTSW 6 85667957 critical splice donor site probably null
R1561:Alms1 UTSW 6 85629052 nonsense probably null
R1648:Alms1 UTSW 6 85678402 missense probably damaging 0.99
R1697:Alms1 UTSW 6 85622454 missense possibly damaging 0.94
R1699:Alms1 UTSW 6 85622880 missense possibly damaging 0.46
R1723:Alms1 UTSW 6 85628753 missense probably damaging 1.00
R1734:Alms1 UTSW 6 85641550 critical splice donor site probably null
R1758:Alms1 UTSW 6 85628505 missense probably damaging 0.99
R1804:Alms1 UTSW 6 85621275 nonsense probably null
R1835:Alms1 UTSW 6 85678503 missense possibly damaging 0.94
R1836:Alms1 UTSW 6 85678503 missense possibly damaging 0.94
R2077:Alms1 UTSW 6 85622309 missense possibly damaging 0.93
R2246:Alms1 UTSW 6 85622967 missense possibly damaging 0.91
R2254:Alms1 UTSW 6 85619848 missense probably damaging 1.00
R2280:Alms1 UTSW 6 85677973 missense probably damaging 0.99
R2516:Alms1 UTSW 6 85667963 splice site probably benign
R2519:Alms1 UTSW 6 85667963 splice site probably benign
R2566:Alms1 UTSW 6 85622482 missense possibly damaging 0.84
R2850:Alms1 UTSW 6 85621299 missense probably benign 0.00
R2850:Alms1 UTSW 6 85667963 splice site probably benign
R2932:Alms1 UTSW 6 85620562 missense possibly damaging 0.89
R2944:Alms1 UTSW 6 85628391 missense probably damaging 1.00
R2980:Alms1 UTSW 6 85628835 missense probably damaging 1.00
R3084:Alms1 UTSW 6 85678140 missense probably benign
R3086:Alms1 UTSW 6 85678140 missense probably benign
R3122:Alms1 UTSW 6 85667963 splice site probably benign
R3404:Alms1 UTSW 6 85667963 splice site probably benign
R3405:Alms1 UTSW 6 85667963 splice site probably benign
R3804:Alms1 UTSW 6 85619647 missense probably damaging 1.00
R3904:Alms1 UTSW 6 85621678 missense probably benign 0.00
R4014:Alms1 UTSW 6 85678352 missense probably benign 0.41
R4056:Alms1 UTSW 6 85587803 missense unknown
R4067:Alms1 UTSW 6 85621289 missense probably damaging 1.00
R4110:Alms1 UTSW 6 85620888 missense probably benign 0.00
R4111:Alms1 UTSW 6 85620888 missense probably benign 0.00
R4112:Alms1 UTSW 6 85620888 missense probably benign 0.00
R4194:Alms1 UTSW 6 85677990 nonsense probably null
R4464:Alms1 UTSW 6 85620021 missense possibly damaging 0.66
R4539:Alms1 UTSW 6 85620478 missense possibly damaging 0.78
R4554:Alms1 UTSW 6 85624617 missense probably benign
R4696:Alms1 UTSW 6 85620522 missense probably damaging 1.00
R4825:Alms1 UTSW 6 85678245 missense probably damaging 0.99
R4921:Alms1 UTSW 6 85628546 missense probably benign 0.13
R5030:Alms1 UTSW 6 85627964 missense probably damaging 0.98
R5051:Alms1 UTSW 6 85627934 nonsense probably null
R5085:Alms1 UTSW 6 85620732 missense possibly damaging 0.55
R5141:Alms1 UTSW 6 85621432 missense probably benign 0.01
R5233:Alms1 UTSW 6 85656371 intron probably null
R5310:Alms1 UTSW 6 85615368 missense possibly damaging 0.79
R5344:Alms1 UTSW 6 85696789 missense probably benign 0.04
R5394:Alms1 UTSW 6 85623088 missense probably benign 0.01
R5460:Alms1 UTSW 6 85696731 missense probably benign 0.08
R5558:Alms1 UTSW 6 85641329 nonsense probably null
R5650:Alms1 UTSW 6 85620271 missense probably damaging 1.00
R5667:Alms1 UTSW 6 85696771 missense probably damaging 0.99
R5671:Alms1 UTSW 6 85629208 missense possibly damaging 0.87
R5688:Alms1 UTSW 6 85599895 missense possibly damaging 0.92
R5815:Alms1 UTSW 6 85622838 missense probably damaging 0.99
R5892:Alms1 UTSW 6 85620903 missense probably damaging 0.99
R5947:Alms1 UTSW 6 85619712 missense probably benign 0.00
R6031:Alms1 UTSW 6 85622955 missense probably damaging 1.00
R6031:Alms1 UTSW 6 85622955 missense probably damaging 1.00
R6144:Alms1 UTSW 6 85623074 missense probably damaging 0.98
R6258:Alms1 UTSW 6 85628735 nonsense probably null
R6260:Alms1 UTSW 6 85628735 nonsense probably null
R6455:Alms1 UTSW 6 85696657 missense probably damaging 0.99
R6569:Alms1 UTSW 6 85641339 missense probably benign 0.07
R6637:Alms1 UTSW 6 85619734 missense possibly damaging 0.78
R6866:Alms1 UTSW 6 85621098 missense possibly damaging 0.85
R6918:Alms1 UTSW 6 85622661 missense possibly damaging 0.87
R7121:Alms1 UTSW 6 85624622 missense probably damaging 1.00
R7179:Alms1 UTSW 6 85621369 missense probably benign 0.09
R7334:Alms1 UTSW 6 85641450 missense probably damaging 0.99
R7376:Alms1 UTSW 6 85622106 missense probably benign 0.10
R7394:Alms1 UTSW 6 85622223 missense possibly damaging 0.54
R7413:Alms1 UTSW 6 85628306 missense probably benign 0.03
R7511:Alms1 UTSW 6 85609425 missense unknown
R7542:Alms1 UTSW 6 85629362 missense possibly damaging 0.62
R7562:Alms1 UTSW 6 85620412 missense probably damaging 1.00
R7575:Alms1 UTSW 6 85622159 missense possibly damaging 0.49
R7577:Alms1 UTSW 6 85615320 missense probably benign 0.09
R7618:Alms1 UTSW 6 85678417 missense probably benign 0.07
R7653:Alms1 UTSW 6 85620595 missense possibly damaging 0.47
R7672:Alms1 UTSW 6 85615351 missense probably damaging 1.00
R7807:Alms1 UTSW 6 85622976 missense possibly damaging 0.91
R7815:Alms1 UTSW 6 85615358 missense probably benign 0.42
R7849:Alms1 UTSW 6 85621497 missense possibly damaging 0.48
R7932:Alms1 UTSW 6 85621497 missense possibly damaging 0.48
R8048:Alms1 UTSW 6 85641334 missense probably benign 0.13
X0013:Alms1 UTSW 6 85656455 missense probably damaging 1.00
X0025:Alms1 UTSW 6 85620210 missense probably damaging 0.96
Z1176:Alms1 UTSW 6 85678418 missense probably benign 0.41
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-05-14