Incidental Mutation 'R1715:Il16'
Institutional Source Beutler Lab
Gene Symbol Il16
Ensembl Gene ENSMUSG00000001741
Gene Nameinterleukin 16
MMRRC Submission 039748-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.197) question?
Stock #R1715 (G1)
Quality Score225
Status Not validated
Chromosomal Location83642825-83745726 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83648728 bp
Amino Acid Change Asparagine to Serine at position 431 (N431S)
Ref Sequence ENSEMBL: ENSMUSP00000146496 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001792] [ENSMUST00000117410] [ENSMUST00000145610]
Predicted Effect probably benign
Transcript: ENSMUST00000001792
AA Change: N1129S

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000001792
Gene: ENSMUSG00000001741
AA Change: N1129S

low complexity region 76 92 N/A INTRINSIC
low complexity region 99 115 N/A INTRINSIC
PDZ 222 300 6.5e-23 SMART
PDZ 361 438 3.89e-12 SMART
low complexity region 507 526 N/A INTRINSIC
low complexity region 556 577 N/A INTRINSIC
low complexity region 589 602 N/A INTRINSIC
low complexity region 647 680 N/A INTRINSIC
low complexity region 776 787 N/A INTRINSIC
low complexity region 825 839 N/A INTRINSIC
low complexity region 978 989 N/A INTRINSIC
PDZ 1115 1192 3.6e-16 SMART
low complexity region 1201 1216 N/A INTRINSIC
PDZ 1234 1310 4.11e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117410
SMART Domains Protein: ENSMUSP00000112781
Gene: ENSMUSG00000046027

Pfam:START 7 196 5.9e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145610
AA Change: N431S

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151047
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a pleiotropic cytokine that functions as a chemoattractant, a modulator of T cell activation, and an inhibitor of HIV replication. The signaling process of this cytokine is mediated by CD4. The product of this gene undergoes proteolytic processing, which is found to yield two functional proteins. The cytokine function is exclusively attributed to the secreted C-terminal peptide, while the N-terminal product may play a role in cell cycle control. Caspase 3 is reported to be involved in the proteolytic processing of this protein. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a knock-out allele display a transient but consistent increase of thymidine incorporation in anti-CD3-stimulated CD4+ T cells, but fail to show a hyperproliferative T cell phenotype using BrdU labeling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700023F06Rik T C 11: 103,199,824 probably null Het
2210010C04Rik A G 6: 41,032,936 probably null Het
2410089E03Rik T A 15: 8,226,900 probably null Het
Abca8a G A 11: 110,091,580 T12M probably damaging Het
Alms1 T A 6: 85,629,052 Y2561* probably null Het
Atp10a G A 7: 58,786,505 V348I probably damaging Het
Best2 T C 8: 85,011,223 Y181C probably benign Het
Btaf1 T A 19: 36,969,121 D442E probably damaging Het
C330027C09Rik C T 16: 49,005,719 T383I probably benign Het
Carmil3 T G 14: 55,504,532 V1153G probably benign Het
Cc2d2a A G 5: 43,718,661 I993M probably damaging Het
Ccng1 G A 11: 40,752,114 P169S probably benign Het
Cmtr2 T C 8: 110,222,798 L580P probably damaging Het
Col22a1 T C 15: 72,006,981 E109G possibly damaging Het
Crispld2 G T 8: 120,023,649 W264L possibly damaging Het
Cyp2c38 T C 19: 39,404,795 H276R probably benign Het
Dag1 A T 9: 108,208,715 V409E possibly damaging Het
Emc8 T C 8: 120,658,555 N146S probably benign Het
Glt8d1 T C 14: 31,011,521 V321A possibly damaging Het
Gm5174 C T 10: 86,656,912 noncoding transcript Het
Hdac10 G T 15: 89,126,709 probably null Het
Hectd4 A G 5: 121,344,818 D3144G possibly damaging Het
Ifna11 C T 4: 88,820,236 S93L probably damaging Het
Irf8 A T 8: 120,754,388 E237V probably damaging Het
Lrp1b A G 2: 41,185,981 Y1769H probably damaging Het
Lrrc9 A G 12: 72,477,299 N761D probably damaging Het
Mbtps1 T C 8: 119,542,730 Y207C probably benign Het
Myo9a A G 9: 59,832,300 E765G probably damaging Het
Nlrp3 A G 11: 59,543,351 D80G probably damaging Het
Olfr361 G A 2: 37,085,176 P191S probably damaging Het
Olfr697 G C 7: 106,741,548 P129A probably damaging Het
Olfr830 A T 9: 18,875,794 I156F probably benign Het
Pcyt2 T A 11: 120,615,851 probably null Het
Plxnd1 T C 6: 115,968,681 T944A probably benign Het
Psd4 A T 2: 24,405,332 I833F probably damaging Het
Psmd7 A G 8: 107,581,185 I222T probably benign Het
Rap2b A G 3: 61,365,190 E45G probably damaging Het
Rbm22 T C 18: 60,560,844 S7P possibly damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Rfx4 A G 10: 84,844,280 N107S probably damaging Het
Ripk2 T A 4: 16,155,192 probably null Het
Rpgrip1 T A 14: 52,140,691 C499S possibly damaging Het
Scarf1 T C 11: 75,524,044 S515P probably damaging Het
Sgip1 T C 4: 102,915,059 V215A probably benign Het
Sis T C 3: 72,889,010 I1813V possibly damaging Het
Slc17a3 A T 13: 23,856,741 T317S probably benign Het
Slc35e1 T C 8: 72,483,977 N340S probably benign Het
Smg6 A G 11: 74,929,430 I176V probably benign Het
Smim17 T C 7: 6,429,326 L89S probably damaging Het
Synm T C 7: 67,736,303 N95S probably damaging Het
Tdrd9 A G 12: 112,036,439 K841E possibly damaging Het
Tep1 G T 14: 50,854,567 F570L possibly damaging Het
Tgm3 G A 2: 130,026,814 probably null Het
Tra2b T C 16: 22,252,746 Y128C possibly damaging Het
Vmn2r17 T C 5: 109,428,244 V327A probably benign Het
Wdr20rt A T 12: 65,227,314 D344V probably damaging Het
Zfp940 A G 7: 29,844,938 C515R probably damaging Het
Other mutations in Il16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Il16 APN 7 83652458 missense probably benign 0.02
IGL01743:Il16 APN 7 83652299 missense probably benign 0.00
IGL01770:Il16 APN 7 83673026 splice site probably benign
IGL02025:Il16 APN 7 83652848 missense probably damaging 1.00
IGL02317:Il16 APN 7 83666889 missense probably damaging 1.00
IGL02412:Il16 APN 7 83652691 missense probably benign 0.03
IGL02550:Il16 APN 7 83674496 missense possibly damaging 0.90
IGL02568:Il16 APN 7 83661276 missense probably damaging 1.00
IGL02578:Il16 APN 7 83677986 critical splice donor site probably null
IGL02815:Il16 APN 7 83651041 missense probably damaging 0.98
IGL03157:Il16 APN 7 83722403 missense probably damaging 1.00
IGL03161:Il16 APN 7 83722499 missense probably damaging 1.00
IGL03188:Il16 APN 7 83688163 missense probably benign 0.00
IGL03213:Il16 APN 7 83646500 missense probably damaging 1.00
IGL03274:Il16 APN 7 83661234 missense probably damaging 1.00
R0201:Il16 UTSW 7 83722308 missense probably damaging 0.99
R0309:Il16 UTSW 7 83722554 missense probably damaging 1.00
R0597:Il16 UTSW 7 83677975 splice site probably benign
R0942:Il16 UTSW 7 83663141 missense probably benign 0.01
R1018:Il16 UTSW 7 83674538 missense probably damaging 1.00
R1434:Il16 UTSW 7 83655312 missense probably benign
R2179:Il16 UTSW 7 83688079 splice site probably null
R2520:Il16 UTSW 7 83651994 missense probably benign 0.03
R3425:Il16 UTSW 7 83644040 missense probably damaging 1.00
R3761:Il16 UTSW 7 83650885 missense possibly damaging 0.96
R3943:Il16 UTSW 7 83652015 missense probably damaging 0.97
R4470:Il16 UTSW 7 83650838 intron probably benign
R4530:Il16 UTSW 7 83681310 intron probably benign
R4583:Il16 UTSW 7 83682899 missense probably damaging 1.00
R4777:Il16 UTSW 7 83650896 missense probably benign 0.14
R4874:Il16 UTSW 7 83660945 missense possibly damaging 0.56
R4876:Il16 UTSW 7 83673094 missense probably benign
R5677:Il16 UTSW 7 83674553 missense probably damaging 1.00
R5686:Il16 UTSW 7 83648728 missense probably benign 0.36
R5920:Il16 UTSW 7 83652344 missense probably benign 0.03
R6115:Il16 UTSW 7 83652567 nonsense probably null
R6459:Il16 UTSW 7 83722321 missense probably damaging 1.00
R6459:Il16 UTSW 7 83722328 missense probably damaging 1.00
R6601:Il16 UTSW 7 83722469 missense probably damaging 1.00
R6616:Il16 UTSW 7 83646476 missense probably benign 0.37
R6642:Il16 UTSW 7 83688127 missense probably benign 0.03
R6721:Il16 UTSW 7 83663062 critical splice donor site probably null
R7009:Il16 UTSW 7 83646388 missense probably benign
R7144:Il16 UTSW 7 83646451 missense probably damaging 0.97
R7346:Il16 UTSW 7 83644041 missense probably damaging 1.00
R7403:Il16 UTSW 7 83670135 missense probably damaging 1.00
R7499:Il16 UTSW 7 83674494 missense probably damaging 0.99
R7814:Il16 UTSW 7 83670140 missense possibly damaging 0.46
R7941:Il16 UTSW 7 83682829 missense probably damaging 0.98
R8098:Il16 UTSW 7 83646559 missense probably damaging 1.00
R8317:Il16 UTSW 7 83655330 missense probably benign
R8437:Il16 UTSW 7 83652143 missense probably damaging 1.00
Z1176:Il16 UTSW 7 83652827 missense probably benign 0.05
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-05-14