Incidental Mutation 'R1715:Or7g18'
ID 190942
Institutional Source Beutler Lab
Gene Symbol Or7g18
Ensembl Gene ENSMUSG00000062868
Gene Name olfactory receptor family 7 subfamily G member 18
Synonyms GA_x6K02T2PVTD-12618399-12619337, Olfr830, MOR152-1
MMRRC Submission 039748-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.122) question?
Stock # R1715 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 18786256-18787572 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 18787090 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 156 (I156F)
Ref Sequence ENSEMBL: ENSMUSP00000077903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078861] [ENSMUST00000212723]
AlphaFold Q8VFJ5
Predicted Effect probably benign
Transcript: ENSMUST00000078861
AA Change: I156F

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000077903
Gene: ENSMUSG00000062868
AA Change: I156F

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 1.8e-51 PFAM
Pfam:7tm_1 44 293 1.6e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212723
AA Change: I153F

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a G A 11: 109,982,406 (GRCm39) T12M probably damaging Het
Alms1 T A 6: 85,606,034 (GRCm39) Y2561* probably null Het
Atp10a G A 7: 58,436,253 (GRCm39) V348I probably damaging Het
Best2 T C 8: 85,737,852 (GRCm39) Y181C probably benign Het
Btaf1 T A 19: 36,946,521 (GRCm39) D442E probably damaging Het
Carmil3 T G 14: 55,741,989 (GRCm39) V1153G probably benign Het
Cc2d2a A G 5: 43,876,003 (GRCm39) I993M probably damaging Het
Ccng1 G A 11: 40,642,941 (GRCm39) P169S probably benign Het
Cip2a C T 16: 48,826,082 (GRCm39) T383I probably benign Het
Cmtr2 T C 8: 110,949,430 (GRCm39) L580P probably damaging Het
Col22a1 T C 15: 71,878,830 (GRCm39) E109G possibly damaging Het
Cplane1 T A 15: 8,256,384 (GRCm39) probably null Het
Crispld2 G T 8: 120,750,388 (GRCm39) W264L possibly damaging Het
Cyp2c38 T C 19: 39,393,239 (GRCm39) H276R probably benign Het
Dag1 A T 9: 108,085,914 (GRCm39) V409E possibly damaging Het
Efcab15 T C 11: 103,090,650 (GRCm39) probably null Het
Emc8 T C 8: 121,385,294 (GRCm39) N146S probably benign Het
Glt8d1 T C 14: 30,733,478 (GRCm39) V321A possibly damaging Het
Gm5174 C T 10: 86,492,776 (GRCm39) noncoding transcript Het
Hdac10 G T 15: 89,010,912 (GRCm39) probably null Het
Hectd4 A G 5: 121,482,881 (GRCm39) D3144G possibly damaging Het
Ifna11 C T 4: 88,738,473 (GRCm39) S93L probably damaging Het
Il16 T C 7: 83,297,936 (GRCm39) N431S probably benign Het
Irf8 A T 8: 121,481,127 (GRCm39) E237V probably damaging Het
Lrp1b A G 2: 41,075,993 (GRCm39) Y1769H probably damaging Het
Lrrc9 A G 12: 72,524,073 (GRCm39) N761D probably damaging Het
Mbtps1 T C 8: 120,269,469 (GRCm39) Y207C probably benign Het
Myo9a A G 9: 59,739,583 (GRCm39) E765G probably damaging Het
Nlrp3 A G 11: 59,434,177 (GRCm39) D80G probably damaging Het
Or12k8 G A 2: 36,975,188 (GRCm39) P191S probably damaging Het
Or2ag15 G C 7: 106,340,755 (GRCm39) P129A probably damaging Het
Pcyt2 T A 11: 120,506,677 (GRCm39) probably null Het
Plxnd1 T C 6: 115,945,642 (GRCm39) T944A probably benign Het
Prss3b A G 6: 41,009,870 (GRCm39) probably null Het
Psd4 A T 2: 24,295,344 (GRCm39) I833F probably damaging Het
Psmd7 A G 8: 108,307,817 (GRCm39) I222T probably benign Het
Rap2b A G 3: 61,272,611 (GRCm39) E45G probably damaging Het
Rbm22 T C 18: 60,693,916 (GRCm39) S7P possibly damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,558,948 (GRCm39) probably benign Het
Rfx4 A G 10: 84,680,144 (GRCm39) N107S probably damaging Het
Ripk2 T A 4: 16,155,192 (GRCm39) probably null Het
Rpgrip1 T A 14: 52,378,148 (GRCm39) C499S possibly damaging Het
Scarf1 T C 11: 75,414,870 (GRCm39) S515P probably damaging Het
Sgip1 T C 4: 102,772,256 (GRCm39) V215A probably benign Het
Sis T C 3: 72,796,343 (GRCm39) I1813V possibly damaging Het
Slc17a3 A T 13: 24,040,724 (GRCm39) T317S probably benign Het
Slc35e1 T C 8: 73,237,821 (GRCm39) N340S probably benign Het
Smg6 A G 11: 74,820,256 (GRCm39) I176V probably benign Het
Smim17 T C 7: 6,432,325 (GRCm39) L89S probably damaging Het
Synm T C 7: 67,386,051 (GRCm39) N95S probably damaging Het
Tdrd9 A G 12: 112,002,873 (GRCm39) K841E possibly damaging Het
Tep1 G T 14: 51,092,024 (GRCm39) F570L possibly damaging Het
Tgm3 G A 2: 129,868,734 (GRCm39) probably null Het
Tra2b T C 16: 22,071,496 (GRCm39) Y128C possibly damaging Het
Vmn2r17 T C 5: 109,576,110 (GRCm39) V327A probably benign Het
Wdr20rt A T 12: 65,274,088 (GRCm39) D344V probably damaging Het
Zfp940 A G 7: 29,544,363 (GRCm39) C515R probably damaging Het
Other mutations in Or7g18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:Or7g18 APN 9 18,787,310 (GRCm39) nonsense probably null
IGL00954:Or7g18 APN 9 18,787,369 (GRCm39) missense probably benign 0.15
IGL01090:Or7g18 APN 9 18,787,538 (GRCm39) missense probably benign 0.00
IGL01613:Or7g18 APN 9 18,786,617 (GRCm39) splice site probably benign
IGL01987:Or7g18 APN 9 18,787,003 (GRCm39) missense probably benign 0.00
IGL03018:Or7g18 APN 9 18,787,523 (GRCm39) missense probably benign 0.15
IGL03037:Or7g18 APN 9 18,786,668 (GRCm39) missense probably damaging 0.98
R0284:Or7g18 UTSW 9 18,786,848 (GRCm39) missense probably benign
R1322:Or7g18 UTSW 9 18,786,817 (GRCm39) missense possibly damaging 0.90
R1803:Or7g18 UTSW 9 18,787,376 (GRCm39) missense probably damaging 1.00
R4360:Or7g18 UTSW 9 18,787,013 (GRCm39) missense probably damaging 1.00
R4394:Or7g18 UTSW 9 18,786,907 (GRCm39) missense probably damaging 0.98
R4642:Or7g18 UTSW 9 18,787,463 (GRCm39) missense probably damaging 1.00
R4796:Or7g18 UTSW 9 18,787,475 (GRCm39) missense probably damaging 0.96
R4814:Or7g18 UTSW 9 18,787,213 (GRCm39) missense probably benign 0.30
R5210:Or7g18 UTSW 9 18,787,103 (GRCm39) missense probably damaging 1.00
R5375:Or7g18 UTSW 9 18,787,442 (GRCm39) missense probably benign 0.08
R6072:Or7g18 UTSW 9 18,786,718 (GRCm39) missense probably benign
R6361:Or7g18 UTSW 9 18,787,027 (GRCm39) missense probably damaging 1.00
R6602:Or7g18 UTSW 9 18,787,145 (GRCm39) missense possibly damaging 0.81
R6920:Or7g18 UTSW 9 18,786,821 (GRCm39) missense probably damaging 1.00
R7730:Or7g18 UTSW 9 18,786,709 (GRCm39) missense probably benign 0.00
R7780:Or7g18 UTSW 9 18,786,910 (GRCm39) missense possibly damaging 0.65
R8245:Or7g18 UTSW 9 18,787,126 (GRCm39) missense probably benign
R8274:Or7g18 UTSW 9 18,786,795 (GRCm39) missense probably benign 0.36
R8920:Or7g18 UTSW 9 18,787,394 (GRCm39) missense probably damaging 1.00
R9564:Or7g18 UTSW 9 18,786,640 (GRCm39) missense probably benign 0.00
X0026:Or7g18 UTSW 9 18,786,931 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGAGGATAACTTTTGCTGGCTGC -3'
(R):5'- AACTGACAAATGAGACCCACAGGTG -3'

Sequencing Primer
(F):5'- GGCTTATGATCGCTACATAGCC -3'
(R):5'- CCTTCTGATGATGGCATTTTCAATAC -3'
Posted On 2014-05-14