Mutagenetix > Incidental Mutations

Incidental Mutation 'R1715:Myo9a'

190943

Institutional Source

Beutler Lab

Gene Symbol

Myo9a

Ensembl Gene

ENSMUSG00000039585

Gene Name

myosin IXa

Synonyms

C130068I12Rik, 4732465J09Rik

MMRRC Submission

039748-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1715 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

59750896-59928866 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 59832300 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 765 (E765G)

Ref Sequence

ENSEMBL: ENSMUSP00000117432 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000128341] [ENSMUST00000135298] [ENSMUST00000136740]

AlphaFold

Q8C170

Predicted Effect

probably damaging
Transcript: ENSMUST00000128341
AA Change: E765G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000119401
Gene: ENSMUSG00000039585
AA Change: E765G

Domain	Start	End	E-Value	Type
RA	14	112	5.57e-30	SMART
low complexity region	129	137	N/A	INTRINSIC
MYSc	140	1018	N/A	SMART
IQ	1019	1041	1.79e1	SMART
IQ	1042	1064	4.11e0	SMART
IQ	1074	1096	1.9e-2	SMART
IQ	1115	1137	1.01e-6	SMART
IQ	1138	1160	8.71e-2	SMART
low complexity region	1161	1173	N/A	INTRINSIC
coiled coil region	1265	1285	N/A	INTRINSIC
low complexity region	1372	1384	N/A	INTRINSIC
coiled coil region	1492	1539	N/A	INTRINSIC
Blast:MYSc	1685	1938	6e-89	BLAST
low complexity region	1982	1993	N/A	INTRINSIC
C1	2002	2050	2.6e-9	SMART
RhoGAP	2075	2250	3.36e-73	SMART
coiled coil region	2320	2360	N/A	INTRINSIC
low complexity region	2419	2438	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000135298
AA Change: E765G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000117432
Gene: ENSMUSG00000039585
AA Change: E765G

Domain	Start	End	E-Value	Type
RA	14	112	5.57e-30	SMART
low complexity region	129	137	N/A	INTRINSIC
MYSc	140	1018	N/A	SMART
IQ	1019	1041	1.79e1	SMART
IQ	1042	1064	4.11e0	SMART
IQ	1074	1096	1.9e-2	SMART
IQ	1115	1137	1.01e-6	SMART
IQ	1138	1160	8.71e-2	SMART
low complexity region	1161	1173	N/A	INTRINSIC
coiled coil region	1265	1285	N/A	INTRINSIC
low complexity region	1372	1384	N/A	INTRINSIC
coiled coil region	1492	1539	N/A	INTRINSIC
low complexity region	1744	1759	N/A	INTRINSIC
low complexity region	2053	2064	N/A	INTRINSIC
C1	2073	2121	2.6e-9	SMART
RhoGAP	2146	2321	3.36e-73	SMART
coiled coil region	2391	2431	N/A	INTRINSIC
low complexity region	2490	2509	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000136740
AA Change: E765G

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000122852
Gene: ENSMUSG00000039585
AA Change: E765G

Domain	Start	End	E-Value	Type
RA	14	112	5.57e-30	SMART
low complexity region	129	137	N/A	INTRINSIC
MYSc	140	1018	N/A	SMART
IQ	1019	1041	1.79e1	SMART
IQ	1042	1064	4.11e0	SMART
IQ	1074	1096	1.9e-2	SMART
IQ	1115	1137	1.01e-6	SMART
IQ	1138	1160	8.71e-2	SMART
low complexity region	1161	1173	N/A	INTRINSIC
coiled coil region	1265	1285	N/A	INTRINSIC
low complexity region	1372	1384	N/A	INTRINSIC
coiled coil region	1492	1539	N/A	INTRINSIC
low complexity region	1744	1759	N/A	INTRINSIC
low complexity region	2053	2064	N/A	INTRINSIC
C1	2073	2121	2.6e-9	SMART
RhoGAP	2146	2321	3.36e-73	SMART
coiled coil region	2409	2449	N/A	INTRINSIC
low complexity region	2508	2527	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215963

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin superfamily. The protein represents an unconventional myosin; it should not be confused with the conventional non-muscle myosin-9 (MYH9). Unconventional myosins contain the basic domains of conventional myosins and are further distinguished from class members by their tail domains. They function as actin-based molecular motors. Mutations in this gene have been associated with Bardet-Biedl Syndrome. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous KO leads to obstructive hydrocephaly caused by blockage of the third ventricle and the rostral aqueduct caused by developmental failures of their ependymal cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700023F06Rik	T	C	11: 103,199,824		probably null	Het
2210010C04Rik	A	G	6: 41,032,936		probably null	Het
2410089E03Rik	T	A	15: 8,226,900		probably null	Het
Abca8a	G	A	11: 110,091,580	T12M	probably damaging	Het
Alms1	T	A	6: 85,629,052	Y2561*	probably null	Het
Atp10a	G	A	7: 58,786,505	V348I	probably damaging	Het
Best2	T	C	8: 85,011,223	Y181C	probably benign	Het
Btaf1	T	A	19: 36,969,121	D442E	probably damaging	Het
C330027C09Rik	C	T	16: 49,005,719	T383I	probably benign	Het
Carmil3	T	G	14: 55,504,532	V1153G	probably benign	Het
Cc2d2a	A	G	5: 43,718,661	I993M	probably damaging	Het
Ccng1	G	A	11: 40,752,114	P169S	probably benign	Het
Cmtr2	T	C	8: 110,222,798	L580P	probably damaging	Het
Col22a1	T	C	15: 72,006,981	E109G	possibly damaging	Het
Crispld2	G	T	8: 120,023,649	W264L	possibly damaging	Het
Cyp2c38	T	C	19: 39,404,795	H276R	probably benign	Het
Dag1	A	T	9: 108,208,715	V409E	possibly damaging	Het
Emc8	T	C	8: 120,658,555	N146S	probably benign	Het
Glt8d1	T	C	14: 31,011,521	V321A	possibly damaging	Het
Gm5174	C	T	10: 86,656,912		noncoding transcript	Het
Hdac10	G	T	15: 89,126,709		probably null	Het
Hectd4	A	G	5: 121,344,818	D3144G	possibly damaging	Het
Ifna11	C	T	4: 88,820,236	S93L	probably damaging	Het
Il16	T	C	7: 83,648,728	N431S	probably benign	Het
Irf8	A	T	8: 120,754,388	E237V	probably damaging	Het
Lrp1b	A	G	2: 41,185,981	Y1769H	probably damaging	Het
Lrrc9	A	G	12: 72,477,299	N761D	probably damaging	Het
Mbtps1	T	C	8: 119,542,730	Y207C	probably benign	Het
Nlrp3	A	G	11: 59,543,351	D80G	probably damaging	Het
Olfr361	G	A	2: 37,085,176	P191S	probably damaging	Het
Olfr697	G	C	7: 106,741,548	P129A	probably damaging	Het
Olfr830	A	T	9: 18,875,794	I156F	probably benign	Het
Pcyt2	T	A	11: 120,615,851		probably null	Het
Plxnd1	T	C	6: 115,968,681	T944A	probably benign	Het
Psd4	A	T	2: 24,405,332	I833F	probably damaging	Het
Psmd7	A	G	8: 107,581,185	I222T	probably benign	Het
Rap2b	A	G	3: 61,365,190	E45G	probably damaging	Het
Rbm22	T	C	18: 60,560,844	S7P	possibly damaging	Het
Rbpms2	ACTGCTGCTGCTGCTGC	ACTGCTGCTGCTGCTGCTGC	9: 65,651,666		probably benign	Het
Rfx4	A	G	10: 84,844,280	N107S	probably damaging	Het
Ripk2	T	A	4: 16,155,192		probably null	Het
Rpgrip1	T	A	14: 52,140,691	C499S	possibly damaging	Het
Scarf1	T	C	11: 75,524,044	S515P	probably damaging	Het
Sgip1	T	C	4: 102,915,059	V215A	probably benign	Het
Sis	T	C	3: 72,889,010	I1813V	possibly damaging	Het
Slc17a3	A	T	13: 23,856,741	T317S	probably benign	Het
Slc35e1	T	C	8: 72,483,977	N340S	probably benign	Het
Smg6	A	G	11: 74,929,430	I176V	probably benign	Het
Smim17	T	C	7: 6,429,326	L89S	probably damaging	Het
Synm	T	C	7: 67,736,303	N95S	probably damaging	Het
Tdrd9	A	G	12: 112,036,439	K841E	possibly damaging	Het
Tep1	G	T	14: 50,854,567	F570L	possibly damaging	Het
Tgm3	G	A	2: 130,026,814		probably null	Het
Tra2b	T	C	16: 22,252,746	Y128C	possibly damaging	Het
Vmn2r17	T	C	5: 109,428,244	V327A	probably benign	Het
Wdr20rt	A	T	12: 65,227,314	D344V	probably damaging	Het
Zfp940	A	G	7: 29,844,938	C515R	probably damaging	Het

Other mutations in Myo9a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00427:Myo9a	APN	9	59843059	splice site	probably benign
IGL00510:Myo9a	APN	9	59832181	splice site	probably benign
IGL00710:Myo9a	APN	9	59875311	missense	probably damaging	1.00
IGL00963:Myo9a	APN	9	59900372	missense	probably damaging	0.98
IGL01087:Myo9a	APN	9	59790078	missense	possibly damaging	0.93
IGL01145:Myo9a	APN	9	59855375	missense	probably benign	0.18
IGL01403:Myo9a	APN	9	59871563	missense	probably damaging	0.98
IGL01528:Myo9a	APN	9	59779674	missense	probably damaging	1.00
IGL01608:Myo9a	APN	9	59870836	nonsense	probably null
IGL01701:Myo9a	APN	9	59884594	critical splice donor site	probably null
IGL01918:Myo9a	APN	9	59779702	missense	probably damaging	1.00
IGL02026:Myo9a	APN	9	59905962	missense	probably damaging	0.99
IGL02139:Myo9a	APN	9	59779992	missense	probably benign	0.07
IGL02176:Myo9a	APN	9	59870553	missense	probably benign	0.45
IGL02272:Myo9a	APN	9	59884600	splice site	probably benign
IGL02283:Myo9a	APN	9	59871673	missense	probably benign	0.00
IGL02499:Myo9a	APN	9	59815386	splice site	probably benign
IGL02652:Myo9a	APN	9	59863928	missense	probably damaging	1.00
IGL02666:Myo9a	APN	9	59924904	missense	probably benign	0.02
IGL02878:Myo9a	APN	9	59908300	critical splice donor site	probably null
IGL02982:Myo9a	APN	9	59908208	nonsense	probably null
IGL03072:Myo9a	APN	9	59809442	missense	possibly damaging	0.83
IGL03090:Myo9a	APN	9	59894135	splice site	probably benign
IGL03111:Myo9a	APN	9	59827243	missense	probably benign	0.19
IGL03389:Myo9a	APN	9	59869607	missense	probably damaging	1.00
essentials	UTSW	9	59894866	missense	probably benign	0.09
necessities	UTSW	9	59815334	missense	probably damaging	1.00
PIT4402001:Myo9a	UTSW	9	59870436	missense	possibly damaging	0.83
R0013:Myo9a	UTSW	9	59860206	splice site	probably benign
R0013:Myo9a	UTSW	9	59860206	splice site	probably benign
R0018:Myo9a	UTSW	9	59871724	missense	probably benign	0.00
R0018:Myo9a	UTSW	9	59871724	missense	probably benign	0.00
R0329:Myo9a	UTSW	9	59923677	missense	probably damaging	1.00
R0423:Myo9a	UTSW	9	59895336	missense	probably damaging	1.00
R0521:Myo9a	UTSW	9	59894352	missense	probably damaging	1.00
R0607:Myo9a	UTSW	9	59921793	missense	probably benign	0.02
R0652:Myo9a	UTSW	9	59871926	missense	probably benign
R0653:Myo9a	UTSW	9	59924991	missense	probably damaging	1.00
R0723:Myo9a	UTSW	9	59871100	missense	probably benign	0.01
R0784:Myo9a	UTSW	9	59896545	splice site	probably benign
R0842:Myo9a	UTSW	9	59871067	missense	probably benign	0.02
R1055:Myo9a	UTSW	9	59855370	missense	probably benign	0.01
R1056:Myo9a	UTSW	9	59832201	missense	possibly damaging	0.64
R1195:Myo9a	UTSW	9	59895200	missense	probably damaging	1.00
R1195:Myo9a	UTSW	9	59895200	missense	probably damaging	1.00
R1195:Myo9a	UTSW	9	59895200	missense	probably damaging	1.00
R1615:Myo9a	UTSW	9	59788456	missense	possibly damaging	0.68
R1698:Myo9a	UTSW	9	59868181	missense	probably benign	0.05
R1981:Myo9a	UTSW	9	59894146	missense	probably benign
R2228:Myo9a	UTSW	9	59894180	missense	probably benign	0.06
R2272:Myo9a	UTSW	9	59815301	missense	probably damaging	1.00
R2327:Myo9a	UTSW	9	59779765	missense	probably benign	0.11
R2990:Myo9a	UTSW	9	59924889	missense	possibly damaging	0.95
R3161:Myo9a	UTSW	9	59832315	splice site	probably benign
R3721:Myo9a	UTSW	9	59868180	missense	probably benign
R3928:Myo9a	UTSW	9	59895283	missense	probably damaging	1.00
R4197:Myo9a	UTSW	9	59894866	missense	probably benign	0.09
R4212:Myo9a	UTSW	9	59906066	nonsense	probably null
R4610:Myo9a	UTSW	9	59871882	missense	probably benign
R4616:Myo9a	UTSW	9	59821649	missense	probably damaging	1.00
R4621:Myo9a	UTSW	9	59871072	missense	probably benign	0.00
R4623:Myo9a	UTSW	9	59871072	missense	probably benign	0.00
R4632:Myo9a	UTSW	9	59869664	missense	probably benign	0.00
R4657:Myo9a	UTSW	9	59875416	critical splice donor site	probably null
R4892:Myo9a	UTSW	9	59824242	missense	probably damaging	0.98
R4897:Myo9a	UTSW	9	59896517	missense	probably benign	0.07
R4966:Myo9a	UTSW	9	59871734	missense	probably benign	0.00
R4993:Myo9a	UTSW	9	59861472	nonsense	probably null
R5160:Myo9a	UTSW	9	59871802	missense	probably benign	0.24
R5233:Myo9a	UTSW	9	59910617	missense	probably damaging	1.00
R5271:Myo9a	UTSW	9	59907382	missense	probably damaging	1.00
R5308:Myo9a	UTSW	9	59863961	missense	probably damaging	1.00
R5367:Myo9a	UTSW	9	59900449	missense	probably damaging	0.96
R5432:Myo9a	UTSW	9	59865670	missense	possibly damaging	0.94
R5459:Myo9a	UTSW	9	59884520	missense	probably damaging	0.98
R5511:Myo9a	UTSW	9	59780212	missense	probably damaging	1.00
R5568:Myo9a	UTSW	9	59874628	missense	probably benign
R5573:Myo9a	UTSW	9	59871001	missense	probably benign
R5589:Myo9a	UTSW	9	59895244	nonsense	probably null
R5607:Myo9a	UTSW	9	59863944	missense	probably damaging	1.00
R5633:Myo9a	UTSW	9	59868184	missense	possibly damaging	0.60
R5885:Myo9a	UTSW	9	59871220	missense	probably benign
R6024:Myo9a	UTSW	9	59855388	missense	possibly damaging	0.68
R6086:Myo9a	UTSW	9	59790057	nonsense	probably null
R6146:Myo9a	UTSW	9	59871229	missense	probably benign	0.01
R6194:Myo9a	UTSW	9	59869750	missense	probably benign	0.00
R6213:Myo9a	UTSW	9	59827258	missense	probably damaging	1.00
R6368:Myo9a	UTSW	9	59924948	missense	probably benign	0.01
R6550:Myo9a	UTSW	9	59868199	missense	probably damaging	1.00
R6612:Myo9a	UTSW	9	59827196	missense	probably damaging	1.00
R6665:Myo9a	UTSW	9	59871872	missense	probably benign	0.09
R6951:Myo9a	UTSW	9	59894768	missense	probably damaging	1.00
R7026:Myo9a	UTSW	9	59815334	missense	probably damaging	1.00
R7107:Myo9a	UTSW	9	59870815	missense	probably benign	0.44
R7310:Myo9a	UTSW	9	59871153	missense	probably benign	0.08
R7473:Myo9a	UTSW	9	59895244	missense	probably benign	0.31
R7723:Myo9a	UTSW	9	59779858	missense	probably damaging	1.00
R7823:Myo9a	UTSW	9	59811950	missense	probably damaging	1.00
R7824:Myo9a	UTSW	9	59860109	missense	probably damaging	1.00
R7965:Myo9a	UTSW	9	59788438	missense	probably damaging	1.00
R8031:Myo9a	UTSW	9	59780091	missense	probably benign	0.33
R8055:Myo9a	UTSW	9	59907460	missense	probably damaging	1.00
R8071:Myo9a	UTSW	9	59874648	missense	probably benign
R8250:Myo9a	UTSW	9	59860109	missense	probably damaging	1.00
R8260:Myo9a	UTSW	9	59910678	missense	probably benign	0.08
R8355:Myo9a	UTSW	9	59909847	missense	probably damaging	1.00
R8432:Myo9a	UTSW	9	59780265	missense	probably damaging	1.00
R8470:Myo9a	UTSW	9	59832290	missense	probably damaging	1.00
R8528:Myo9a	UTSW	9	59860140	missense	probably damaging	1.00
R8681:Myo9a	UTSW	9	59868111	missense	probably benign	0.16
R8690:Myo9a	UTSW	9	59875374	missense	probably benign
R8793:Myo9a	UTSW	9	59884567	missense	probably benign	0.03
R8812:Myo9a	UTSW	9	59779747	missense	probably benign	0.14
R9016:Myo9a	UTSW	9	59868144	nonsense	probably null
R9026:Myo9a	UTSW	9	59809474	missense	probably damaging	0.96
R9036:Myo9a	UTSW	9	59780301	nonsense	probably null
R9130:Myo9a	UTSW	9	59832231	missense	probably damaging	0.98
R9131:Myo9a	UTSW	9	59861489	missense	probably damaging	1.00
R9213:Myo9a	UTSW	9	59865639	missense	probably benign	0.04
RF018:Myo9a	UTSW	9	59869586	missense	probably benign	0.00
RF019:Myo9a	UTSW	9	59921772	missense	probably benign	0.00
Z1176:Myo9a	UTSW	9	59895259	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCACACACTCGGCAGACATTG -3'
(R):5'- TGGTGCATAGCAAATGGGACAGTC -3'

Sequencing Primer
(F):5'- TGGGGAGAGTTATTCACATGG -3'
(R):5'- CATAGCAAATGGGACAGTCAAAATC -3'

Posted On

2014-05-14