Incidental Mutation 'R1715:Abca8a'
ID190953
Institutional Source Beutler Lab
Gene Symbol Abca8a
Ensembl Gene ENSMUSG00000041828
Gene NameATP-binding cassette, sub-family A (ABC1), member 8a
Synonyms
MMRRC Submission 039748-MU
Accession Numbers

Genbank: NM_153145

Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R1715 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location110025634-110095978 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 110091580 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 12 (T12M)
Ref Sequence ENSEMBL: ENSMUSP00000045808 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046223] [ENSMUST00000100287] [ENSMUST00000106662] [ENSMUST00000106664]
Predicted Effect probably damaging
Transcript: ENSMUST00000046223
AA Change: T12M

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000045808
Gene: ENSMUSG00000041828
AA Change: T12M

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 27 416 8e-26 PFAM
AAA 505 689 6.27e-9 SMART
Pfam:ABC2_membrane_3 860 1174 6.8e-15 PFAM
transmembrane domain 1196 1218 N/A INTRINSIC
low complexity region 1246 1255 N/A INTRINSIC
low complexity region 1288 1301 N/A INTRINSIC
AAA 1313 1493 4.3e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000100287
AA Change: T12M

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097860
Gene: ENSMUSG00000041828
AA Change: T12M

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 27 416 3.9e-26 PFAM
AAA 506 690 6.27e-9 SMART
Pfam:ABC2_membrane_3 861 1175 3.3e-15 PFAM
transmembrane domain 1197 1219 N/A INTRINSIC
low complexity region 1247 1256 N/A INTRINSIC
low complexity region 1289 1302 N/A INTRINSIC
AAA 1314 1494 4.3e-7 SMART
Predicted Effect unknown
Transcript: ENSMUST00000106662
AA Change: T12M
SMART Domains Protein: ENSMUSP00000102273
Gene: ENSMUSG00000041828
AA Change: T12M

DomainStartEndE-ValueType
low complexity region 15 33 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106664
AA Change: T12M

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102275
Gene: ENSMUSG00000041828
AA Change: T12M

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 28 416 1.7e-23 PFAM
AAA 506 690 6.27e-9 SMART
Pfam:ABC2_membrane_3 861 1214 1.3e-12 PFAM
low complexity region 1247 1256 N/A INTRINSIC
low complexity region 1289 1302 N/A INTRINSIC
AAA 1314 1494 4.3e-7 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700023F06Rik T C 11: 103,199,824 probably null Het
2210010C04Rik A G 6: 41,032,936 probably null Het
2410089E03Rik T A 15: 8,226,900 probably null Het
Alms1 T A 6: 85,629,052 Y2561* probably null Het
Atp10a G A 7: 58,786,505 V348I probably damaging Het
Best2 T C 8: 85,011,223 Y181C probably benign Het
Btaf1 T A 19: 36,969,121 D442E probably damaging Het
C330027C09Rik C T 16: 49,005,719 T383I probably benign Het
Carmil3 T G 14: 55,504,532 V1153G probably benign Het
Cc2d2a A G 5: 43,718,661 I993M probably damaging Het
Ccng1 G A 11: 40,752,114 P169S probably benign Het
Cmtr2 T C 8: 110,222,798 L580P probably damaging Het
Col22a1 T C 15: 72,006,981 E109G possibly damaging Het
Crispld2 G T 8: 120,023,649 W264L possibly damaging Het
Cyp2c38 T C 19: 39,404,795 H276R probably benign Het
Dag1 A T 9: 108,208,715 V409E possibly damaging Het
Emc8 T C 8: 120,658,555 N146S probably benign Het
Glt8d1 T C 14: 31,011,521 V321A possibly damaging Het
Gm5174 C T 10: 86,656,912 noncoding transcript Het
Hdac10 G T 15: 89,126,709 probably null Het
Hectd4 A G 5: 121,344,818 D3144G possibly damaging Het
Ifna11 C T 4: 88,820,236 S93L probably damaging Het
Il16 T C 7: 83,648,728 N431S probably benign Het
Irf8 A T 8: 120,754,388 E237V probably damaging Het
Lrp1b A G 2: 41,185,981 Y1769H probably damaging Het
Lrrc9 A G 12: 72,477,299 N761D probably damaging Het
Mbtps1 T C 8: 119,542,730 Y207C probably benign Het
Myo9a A G 9: 59,832,300 E765G probably damaging Het
Nlrp3 A G 11: 59,543,351 D80G probably damaging Het
Olfr361 G A 2: 37,085,176 P191S probably damaging Het
Olfr697 G C 7: 106,741,548 P129A probably damaging Het
Olfr830 A T 9: 18,875,794 I156F probably benign Het
Pcyt2 T A 11: 120,615,851 probably null Het
Plxnd1 T C 6: 115,968,681 T944A probably benign Het
Psd4 A T 2: 24,405,332 I833F probably damaging Het
Psmd7 A G 8: 107,581,185 I222T probably benign Het
Rap2b A G 3: 61,365,190 E45G probably damaging Het
Rbm22 T C 18: 60,560,844 S7P possibly damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Rfx4 A G 10: 84,844,280 N107S probably damaging Het
Ripk2 T A 4: 16,155,192 probably null Het
Rpgrip1 T A 14: 52,140,691 C499S possibly damaging Het
Scarf1 T C 11: 75,524,044 S515P probably damaging Het
Sgip1 T C 4: 102,915,059 V215A probably benign Het
Sis T C 3: 72,889,010 I1813V possibly damaging Het
Slc17a3 A T 13: 23,856,741 T317S probably benign Het
Slc35e1 T C 8: 72,483,977 N340S probably benign Het
Smg6 A G 11: 74,929,430 I176V probably benign Het
Smim17 T C 7: 6,429,326 L89S probably damaging Het
Synm T C 7: 67,736,303 N95S probably damaging Het
Tdrd9 A G 12: 112,036,439 K841E possibly damaging Het
Tep1 G T 14: 50,854,567 F570L possibly damaging Het
Tgm3 G A 2: 130,026,814 probably null Het
Tra2b T C 16: 22,252,746 Y128C possibly damaging Het
Vmn2r17 T C 5: 109,428,244 V327A probably benign Het
Wdr20rt A T 12: 65,227,314 D344V probably damaging Het
Zfp940 A G 7: 29,844,938 C515R probably damaging Het
Other mutations in Abca8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Abca8a APN 11 110050939 missense possibly damaging 0.52
IGL01099:Abca8a APN 11 110074205 splice site probably benign
IGL01100:Abca8a APN 11 110058423 critical splice donor site probably null
IGL01310:Abca8a APN 11 110059975 missense probably benign 0.02
IGL01357:Abca8a APN 11 110031572 missense probably benign 0.05
IGL01554:Abca8a APN 11 110042166 missense probably benign 0.24
IGL01937:Abca8a APN 11 110083304 splice site probably benign
IGL01945:Abca8a APN 11 110083304 splice site probably benign
IGL01987:Abca8a APN 11 110074155 missense possibly damaging 0.63
IGL02023:Abca8a APN 11 110063116 missense probably benign 0.04
IGL02208:Abca8a APN 11 110059946 missense probably damaging 1.00
IGL02378:Abca8a APN 11 110078815 unclassified probably benign
IGL02380:Abca8a APN 11 110078815 unclassified probably benign
IGL02387:Abca8a APN 11 110078815 unclassified probably benign
IGL02388:Abca8a APN 11 110078815 unclassified probably benign
IGL02524:Abca8a APN 11 110078815 unclassified probably benign
IGL02551:Abca8a APN 11 110084242 missense probably benign 0.05
IGL02831:Abca8a APN 11 110053081 missense probably damaging 1.00
IGL02836:Abca8a APN 11 110070351 missense possibly damaging 0.89
IGL02934:Abca8a APN 11 110040588 missense probably damaging 1.00
IGL02946:Abca8a APN 11 110028215 splice site probably benign
IGL02967:Abca8a APN 11 110050936 missense probably damaging 1.00
IGL02997:Abca8a APN 11 110075533 splice site probably benign
IGL03265:Abca8a APN 11 110053103 missense probably benign 0.01
G5030:Abca8a UTSW 11 110070339 missense probably damaging 1.00
H8562:Abca8a UTSW 11 110043009 missense probably benign
PIT4445001:Abca8a UTSW 11 110075551 missense probably damaging 0.99
R0060:Abca8a UTSW 11 110070480 missense probably damaging 1.00
R0060:Abca8a UTSW 11 110070480 missense probably damaging 1.00
R0084:Abca8a UTSW 11 110036597 splice site probably benign
R0394:Abca8a UTSW 11 110026343 missense probably damaging 0.99
R0477:Abca8a UTSW 11 110065225 missense probably benign
R0593:Abca8a UTSW 11 110068099 missense probably damaging 1.00
R0744:Abca8a UTSW 11 110040564 missense possibly damaging 0.91
R0764:Abca8a UTSW 11 110059946 missense probably damaging 1.00
R0787:Abca8a UTSW 11 110042988 missense possibly damaging 0.60
R0836:Abca8a UTSW 11 110040564 missense possibly damaging 0.91
R0848:Abca8a UTSW 11 110028190 missense probably damaging 1.00
R0894:Abca8a UTSW 11 110050966 missense probably benign 0.00
R1163:Abca8a UTSW 11 110071530 missense probably benign 0.01
R1224:Abca8a UTSW 11 110040582 missense probably damaging 1.00
R1474:Abca8a UTSW 11 110069809 missense probably damaging 1.00
R1596:Abca8a UTSW 11 110068060 missense possibly damaging 0.89
R1708:Abca8a UTSW 11 110053102 missense probably damaging 1.00
R1795:Abca8a UTSW 11 110050966 missense probably benign 0.00
R1832:Abca8a UTSW 11 110071451 missense probably damaging 0.99
R1852:Abca8a UTSW 11 110069386 missense probably damaging 1.00
R1887:Abca8a UTSW 11 110089942 missense probably damaging 1.00
R1891:Abca8a UTSW 11 110091607 missense probably benign 0.20
R1917:Abca8a UTSW 11 110091515 splice site probably benign
R1943:Abca8a UTSW 11 110069863 missense probably benign 0.00
R1962:Abca8a UTSW 11 110026905 critical splice acceptor site probably null
R2016:Abca8a UTSW 11 110070387 missense probably damaging 0.99
R2037:Abca8a UTSW 11 110089984 splice site probably null
R2098:Abca8a UTSW 11 110036579 missense probably damaging 1.00
R2102:Abca8a UTSW 11 110068052 missense probably damaging 1.00
R2134:Abca8a UTSW 11 110030917 missense probably null 1.00
R2220:Abca8a UTSW 11 110026855 missense probably damaging 1.00
R2269:Abca8a UTSW 11 110026892 missense probably damaging 1.00
R2395:Abca8a UTSW 11 110068788 missense probably damaging 1.00
R2847:Abca8a UTSW 11 110042105 missense probably damaging 1.00
R2849:Abca8a UTSW 11 110042105 missense probably damaging 1.00
R3508:Abca8a UTSW 11 110063165 missense probably benign
R3974:Abca8a UTSW 11 110083502 missense probably damaging 1.00
R4009:Abca8a UTSW 11 110090107 missense probably damaging 0.98
R4163:Abca8a UTSW 11 110050982 missense probably benign 0.00
R4274:Abca8a UTSW 11 110090104 missense probably damaging 0.96
R4507:Abca8a UTSW 11 110063025 missense probably benign 0.19
R4571:Abca8a UTSW 11 110030058 missense probably damaging 1.00
R4672:Abca8a UTSW 11 110071876 missense possibly damaging 0.94
R4700:Abca8a UTSW 11 110070482 missense probably damaging 1.00
R4770:Abca8a UTSW 11 110071515 missense possibly damaging 0.82
R4946:Abca8a UTSW 11 110086474 missense probably damaging 1.00
R4955:Abca8a UTSW 11 110036512 missense probably benign 0.00
R5186:Abca8a UTSW 11 110091599 missense probably null 0.31
R5190:Abca8a UTSW 11 110089909 critical splice donor site probably null
R5597:Abca8a UTSW 11 110036537 missense probably damaging 1.00
R5677:Abca8a UTSW 11 110038399 missense possibly damaging 0.51
R5757:Abca8a UTSW 11 110042968 missense probably benign 0.28
R5822:Abca8a UTSW 11 110030879 missense probably damaging 0.98
R5925:Abca8a UTSW 11 110057223 missense probably damaging 1.00
R6090:Abca8a UTSW 11 110063222 critical splice acceptor site probably null
R6122:Abca8a UTSW 11 110070423 missense probably benign 0.40
R6189:Abca8a UTSW 11 110030884 missense probably damaging 1.00
R6200:Abca8a UTSW 11 110090050 missense probably damaging 0.98
R6374:Abca8a UTSW 11 110083390 nonsense probably null
R7022:Abca8a UTSW 11 110083500 missense probably damaging 1.00
R7161:Abca8a UTSW 11 110074142 missense probably benign 0.09
R7198:Abca8a UTSW 11 110078655 missense probably damaging 1.00
R7220:Abca8a UTSW 11 110089967 missense probably benign 0.00
R7290:Abca8a UTSW 11 110030888 missense probably benign 0.03
R7381:Abca8a UTSW 11 110030087 splice site probably null
R7437:Abca8a UTSW 11 110050964 missense probably benign
R7733:Abca8a UTSW 11 110054587 missense probably benign 0.02
R7785:Abca8a UTSW 11 110074206 splice site probably null
R7917:Abca8a UTSW 11 110068107 missense probably damaging 1.00
R7948:Abca8a UTSW 11 110050979 missense probably benign
R7957:Abca8a UTSW 11 110091613 start codon destroyed probably null 1.00
R7958:Abca8a UTSW 11 110031672 missense probably damaging 1.00
R7981:Abca8a UTSW 11 110089913 missense probably benign 0.00
R8033:Abca8a UTSW 11 110036522 missense probably damaging 1.00
R8069:Abca8a UTSW 11 110090050 missense probably damaging 0.98
R8116:Abca8a UTSW 11 110091594 missense probably benign 0.27
R8289:Abca8a UTSW 11 110036689 intron probably benign
R8334:Abca8a UTSW 11 110068824 missense probably damaging 1.00
R8371:Abca8a UTSW 11 110054647 missense probably benign 0.31
R8406:Abca8a UTSW 11 110086517 missense probably damaging 1.00
R8438:Abca8a UTSW 11 110075578 missense probably damaging 1.00
X0022:Abca8a UTSW 11 110031097 missense probably damaging 1.00
X0024:Abca8a UTSW 11 110083335 missense probably damaging 1.00
X0053:Abca8a UTSW 11 110083484 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGGAGCCATGATTTTCTTCCCAGC -3'
(R):5'- AGGGCACCATTACTGTTCATGACAC -3'

Sequencing Primer
(F):5'- CAGCGGTGTCTCTAGTCCTTG -3'
(R):5'- AGGGCATCATTCAAGCCTG -3'
Posted On2014-05-14