Incidental Mutation 'R1715:Slc17a3'
ID190958
Institutional Source Beutler Lab
Gene Symbol Slc17a3
Ensembl Gene ENSMUSG00000036083
Gene Namesolute carrier family 17 (sodium phosphate), member 3
SynonymsNpt4
MMRRC Submission 039748-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1715 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location23839434-23860716 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 23856741 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 317 (T317S)
Ref Sequence ENSEMBL: ENSMUSP00000089290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039721] [ENSMUST00000091698] [ENSMUST00000110422] [ENSMUST00000166467]
Predicted Effect probably benign
Transcript: ENSMUST00000039721
AA Change: T395S

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000039062
Gene: ENSMUSG00000036083
AA Change: T395S

DomainStartEndE-ValueType
Pfam:MFS_1 45 377 3.3e-46 PFAM
transmembrane domain 393 415 N/A INTRINSIC
transmembrane domain 430 452 N/A INTRINSIC
transmembrane domain 459 481 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000091698
AA Change: T317S

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000089290
Gene: ENSMUSG00000036083
AA Change: T317S

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
Pfam:MFS_1 95 293 2.8e-25 PFAM
transmembrane domain 310 332 N/A INTRINSIC
transmembrane domain 352 369 N/A INTRINSIC
transmembrane domain 379 398 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110422
AA Change: T359S

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000106052
Gene: ENSMUSG00000036083
AA Change: T359S

DomainStartEndE-ValueType
Pfam:MFS_1 39 425 6.7e-47 PFAM
transmembrane domain 453 475 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166467
AA Change: T395S

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000131308
Gene: ENSMUSG00000036083
AA Change: T395S

DomainStartEndE-ValueType
Pfam:MFS_1 9 338 2.3e-46 PFAM
transmembrane domain 357 379 N/A INTRINSIC
transmembrane domain 394 416 N/A INTRINSIC
transmembrane domain 423 445 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a voltage-driven transporter that excretes intracellular urate and organic anions from the blood into renal tubule cells. Two transcript variants encoding different isoforms have been found for this gene. The longer isoform is a plasma membrane protein with transporter activity while the shorter isoform localizes to the endoplasmic reticulum. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700023F06Rik T C 11: 103,199,824 probably null Het
2210010C04Rik A G 6: 41,032,936 probably null Het
2410089E03Rik T A 15: 8,226,900 probably null Het
Abca8a G A 11: 110,091,580 T12M probably damaging Het
Alms1 T A 6: 85,629,052 Y2561* probably null Het
Atp10a G A 7: 58,786,505 V348I probably damaging Het
Best2 T C 8: 85,011,223 Y181C probably benign Het
Btaf1 T A 19: 36,969,121 D442E probably damaging Het
C330027C09Rik C T 16: 49,005,719 T383I probably benign Het
Carmil3 T G 14: 55,504,532 V1153G probably benign Het
Cc2d2a A G 5: 43,718,661 I993M probably damaging Het
Ccng1 G A 11: 40,752,114 P169S probably benign Het
Cmtr2 T C 8: 110,222,798 L580P probably damaging Het
Col22a1 T C 15: 72,006,981 E109G possibly damaging Het
Crispld2 G T 8: 120,023,649 W264L possibly damaging Het
Cyp2c38 T C 19: 39,404,795 H276R probably benign Het
Dag1 A T 9: 108,208,715 V409E possibly damaging Het
Emc8 T C 8: 120,658,555 N146S probably benign Het
Glt8d1 T C 14: 31,011,521 V321A possibly damaging Het
Gm5174 C T 10: 86,656,912 noncoding transcript Het
Hdac10 G T 15: 89,126,709 probably null Het
Hectd4 A G 5: 121,344,818 D3144G possibly damaging Het
Ifna11 C T 4: 88,820,236 S93L probably damaging Het
Il16 T C 7: 83,648,728 N431S probably benign Het
Irf8 A T 8: 120,754,388 E237V probably damaging Het
Lrp1b A G 2: 41,185,981 Y1769H probably damaging Het
Lrrc9 A G 12: 72,477,299 N761D probably damaging Het
Mbtps1 T C 8: 119,542,730 Y207C probably benign Het
Myo9a A G 9: 59,832,300 E765G probably damaging Het
Nlrp3 A G 11: 59,543,351 D80G probably damaging Het
Olfr361 G A 2: 37,085,176 P191S probably damaging Het
Olfr697 G C 7: 106,741,548 P129A probably damaging Het
Olfr830 A T 9: 18,875,794 I156F probably benign Het
Pcyt2 T A 11: 120,615,851 probably null Het
Plxnd1 T C 6: 115,968,681 T944A probably benign Het
Psd4 A T 2: 24,405,332 I833F probably damaging Het
Psmd7 A G 8: 107,581,185 I222T probably benign Het
Rap2b A G 3: 61,365,190 E45G probably damaging Het
Rbm22 T C 18: 60,560,844 S7P possibly damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Rfx4 A G 10: 84,844,280 N107S probably damaging Het
Ripk2 T A 4: 16,155,192 probably null Het
Rpgrip1 T A 14: 52,140,691 C499S possibly damaging Het
Scarf1 T C 11: 75,524,044 S515P probably damaging Het
Sgip1 T C 4: 102,915,059 V215A probably benign Het
Sis T C 3: 72,889,010 I1813V possibly damaging Het
Slc35e1 T C 8: 72,483,977 N340S probably benign Het
Smg6 A G 11: 74,929,430 I176V probably benign Het
Smim17 T C 7: 6,429,326 L89S probably damaging Het
Synm T C 7: 67,736,303 N95S probably damaging Het
Tdrd9 A G 12: 112,036,439 K841E possibly damaging Het
Tep1 G T 14: 50,854,567 F570L possibly damaging Het
Tgm3 G A 2: 130,026,814 probably null Het
Tra2b T C 16: 22,252,746 Y128C possibly damaging Het
Vmn2r17 T C 5: 109,428,244 V327A probably benign Het
Wdr20rt A T 12: 65,227,314 D344V probably damaging Het
Zfp940 A G 7: 29,844,938 C515R probably damaging Het
Other mutations in Slc17a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00920:Slc17a3 APN 13 23856481 missense probably benign 0.20
IGL02569:Slc17a3 APN 13 23846302 missense probably damaging 1.00
IGL02628:Slc17a3 APN 13 23842451 start codon destroyed probably null 1.00
IGL02745:Slc17a3 APN 13 23842486 missense probably benign 0.01
IGL03001:Slc17a3 APN 13 23856784 missense probably damaging 1.00
IGL03143:Slc17a3 APN 13 23855979 splice site probably null
IGL03144:Slc17a3 APN 13 23846440 missense probably benign 0.00
R0052:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0054:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0131:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0131:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0152:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0153:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0233:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0234:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0257:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0294:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0295:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0318:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0319:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0352:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0462:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0610:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0627:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0652:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0765:Slc17a3 UTSW 13 23846896 nonsense probably null
R1529:Slc17a3 UTSW 13 23845445 missense probably damaging 1.00
R1532:Slc17a3 UTSW 13 23856500 missense probably damaging 1.00
R1569:Slc17a3 UTSW 13 23855608 missense probably benign 0.09
R1640:Slc17a3 UTSW 13 23852357 nonsense probably null
R1643:Slc17a3 UTSW 13 23857198 splice site probably benign
R2407:Slc17a3 UTSW 13 23852435 critical splice donor site probably null
R2512:Slc17a3 UTSW 13 23846247 missense probably benign 0.13
R3923:Slc17a3 UTSW 13 23858054 missense possibly damaging 0.89
R4449:Slc17a3 UTSW 13 23856732 missense probably damaging 0.99
R5166:Slc17a3 UTSW 13 23842542 critical splice donor site probably null
R5748:Slc17a3 UTSW 13 23856466 missense probably damaging 1.00
R5989:Slc17a3 UTSW 13 23842428 start gained probably benign
R6281:Slc17a3 UTSW 13 23856799 missense probably benign 0.17
R6811:Slc17a3 UTSW 13 23855941 missense possibly damaging 0.61
R7283:Slc17a3 UTSW 13 23855848 missense
R7341:Slc17a3 UTSW 13 23846884 nonsense probably null
R7467:Slc17a3 UTSW 13 23846967 critical splice donor site probably null
R7485:Slc17a3 UTSW 13 23855849 missense
R8065:Slc17a3 UTSW 13 23858087 missense unknown
Predicted Primers PCR Primer
(F):5'- GAGATTGCCAACACGTTTGCTCC -3'
(R):5'- GGCTCCCAGAACATTATAGGCTGC -3'

Sequencing Primer
(F):5'- CTGGCAGATTTTCTACTGAGCAAG -3'
(R):5'- GCTTTTTTCCCCAGAAAATGTG -3'
Posted On2014-05-14