Mutagenetix > Incidental Mutations

Incidental Mutation 'R1715:Rpgrip1'

190961

Institutional Source

Beutler Lab

Gene Symbol

Rpgrip1

Ensembl Gene

ENSMUSG00000057132

Gene Name

retinitis pigmentosa GTPase regulator interacting protein 1

Synonyms

A930002K18Rik, 4930505G06Rik, 4930401L23Rik, nmf247

MMRRC Submission

039748-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.258) question?

Stock #

R1715 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

52110704-52163546 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 52140691 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 499 (C499S)

Ref Sequence

ENSEMBL: ENSMUSP00000138027 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000111600] [ENSMUST00000111603] [ENSMUST00000180646] [ENSMUST00000181401]

AlphaFold

Q9EPQ2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000111600
AA Change: C499S

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000107227
Gene: ENSMUSG00000057132
AA Change: C499S

Domain	Start	End	E-Value	Type
low complexity region	98	119	N/A	INTRINSIC
coiled coil region	248	348	N/A	INTRINSIC
coiled coil region	499	542	N/A	INTRINSIC
C2	602	707	1.08e-2	SMART
coiled coil region	746	795	N/A	INTRINSIC
Blast:C2	958	1086	1e-37	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000111603
AA Change: C499S

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000107230
Gene: ENSMUSG00000057132
AA Change: C499S

Domain	Start	End	E-Value	Type
low complexity region	98	119	N/A	INTRINSIC
coiled coil region	248	348	N/A	INTRINSIC
coiled coil region	499	543	N/A	INTRINSIC
Pfam:C2-C2_1	582	721	1.9e-49	PFAM
C2	764	869	7.3e-5	SMART
coiled coil region	910	999	N/A	INTRINSIC
Blast:C2	1162	1290	2e-37	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000180513

Predicted Effect

probably benign
Transcript: ENSMUST00000180646

SMART Domains

Protein: ENSMUSP00000137751
Gene: ENSMUSG00000057132

Domain	Start	End	E-Value	Type
low complexity region	98	119	N/A	INTRINSIC
coiled coil region	248	276	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000180901

SMART Domains

Protein: ENSMUSP00000137826
Gene: ENSMUSG00000057132

Domain	Start	End	E-Value	Type
coiled coil region	179	223	N/A	INTRINSIC
coiled coil region	274	363	N/A	INTRINSIC
Blast:C2	526	654	2e-38	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000181297

SMART Domains

Protein: ENSMUSP00000137653
Gene: ENSMUSG00000057132

Domain	Start	End	E-Value	Type
coiled coil region	180	224	N/A	INTRINSIC
low complexity region	257	284	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000181401
AA Change: C499S

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000138027
Gene: ENSMUSG00000057132
AA Change: C499S

Domain	Start	End	E-Value	Type
low complexity region	98	119	N/A	INTRINSIC
coiled coil region	248	348	N/A	INTRINSIC
coiled coil region	499	547	N/A	INTRINSIC
Pfam:DUF3250	605	710	2.8e-46	PFAM
C2	753	858	1.08e-2	SMART
coiled coil region	899	988	N/A	INTRINSIC
Blast:C2	1151	1279	1e-37	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000181627

Predicted Effect

probably benign
Transcript: ENSMUST00000181709

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000181823

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a photoreceptor protein that interacts with retinitis pigmentosa GTPase regulator protein and is a key component of cone and rod photoreceptor cells. Mutations in this gene lead to autosomal recessive congenital blindness. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous mutation of this gene results in photoreceptor cell dysmorphology. By 3 months of age mutant animals show near complete loss of photoreceptor cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700023F06Rik	T	C	11: 103,199,824		probably null	Het
2210010C04Rik	A	G	6: 41,032,936		probably null	Het
2410089E03Rik	T	A	15: 8,226,900		probably null	Het
Abca8a	G	A	11: 110,091,580	T12M	probably damaging	Het
Alms1	T	A	6: 85,629,052	Y2561*	probably null	Het
Atp10a	G	A	7: 58,786,505	V348I	probably damaging	Het
Best2	T	C	8: 85,011,223	Y181C	probably benign	Het
Btaf1	T	A	19: 36,969,121	D442E	probably damaging	Het
C330027C09Rik	C	T	16: 49,005,719	T383I	probably benign	Het
Carmil3	T	G	14: 55,504,532	V1153G	probably benign	Het
Cc2d2a	A	G	5: 43,718,661	I993M	probably damaging	Het
Ccng1	G	A	11: 40,752,114	P169S	probably benign	Het
Cmtr2	T	C	8: 110,222,798	L580P	probably damaging	Het
Col22a1	T	C	15: 72,006,981	E109G	possibly damaging	Het
Crispld2	G	T	8: 120,023,649	W264L	possibly damaging	Het
Cyp2c38	T	C	19: 39,404,795	H276R	probably benign	Het
Dag1	A	T	9: 108,208,715	V409E	possibly damaging	Het
Emc8	T	C	8: 120,658,555	N146S	probably benign	Het
Glt8d1	T	C	14: 31,011,521	V321A	possibly damaging	Het
Gm5174	C	T	10: 86,656,912		noncoding transcript	Het
Hdac10	G	T	15: 89,126,709		probably null	Het
Hectd4	A	G	5: 121,344,818	D3144G	possibly damaging	Het
Ifna11	C	T	4: 88,820,236	S93L	probably damaging	Het
Il16	T	C	7: 83,648,728	N431S	probably benign	Het
Irf8	A	T	8: 120,754,388	E237V	probably damaging	Het
Lrp1b	A	G	2: 41,185,981	Y1769H	probably damaging	Het
Lrrc9	A	G	12: 72,477,299	N761D	probably damaging	Het
Mbtps1	T	C	8: 119,542,730	Y207C	probably benign	Het
Myo9a	A	G	9: 59,832,300	E765G	probably damaging	Het
Nlrp3	A	G	11: 59,543,351	D80G	probably damaging	Het
Olfr361	G	A	2: 37,085,176	P191S	probably damaging	Het
Olfr697	G	C	7: 106,741,548	P129A	probably damaging	Het
Olfr830	A	T	9: 18,875,794	I156F	probably benign	Het
Pcyt2	T	A	11: 120,615,851		probably null	Het
Plxnd1	T	C	6: 115,968,681	T944A	probably benign	Het
Psd4	A	T	2: 24,405,332	I833F	probably damaging	Het
Psmd7	A	G	8: 107,581,185	I222T	probably benign	Het
Rap2b	A	G	3: 61,365,190	E45G	probably damaging	Het
Rbm22	T	C	18: 60,560,844	S7P	possibly damaging	Het
Rbpms2	ACTGCTGCTGCTGCTGC	ACTGCTGCTGCTGCTGCTGC	9: 65,651,666		probably benign	Het
Rfx4	A	G	10: 84,844,280	N107S	probably damaging	Het
Ripk2	T	A	4: 16,155,192		probably null	Het
Scarf1	T	C	11: 75,524,044	S515P	probably damaging	Het
Sgip1	T	C	4: 102,915,059	V215A	probably benign	Het
Sis	T	C	3: 72,889,010	I1813V	possibly damaging	Het
Slc17a3	A	T	13: 23,856,741	T317S	probably benign	Het
Slc35e1	T	C	8: 72,483,977	N340S	probably benign	Het
Smg6	A	G	11: 74,929,430	I176V	probably benign	Het
Smim17	T	C	7: 6,429,326	L89S	probably damaging	Het
Synm	T	C	7: 67,736,303	N95S	probably damaging	Het
Tdrd9	A	G	12: 112,036,439	K841E	possibly damaging	Het
Tep1	G	T	14: 50,854,567	F570L	possibly damaging	Het
Tgm3	G	A	2: 130,026,814		probably null	Het
Tra2b	T	C	16: 22,252,746	Y128C	possibly damaging	Het
Vmn2r17	T	C	5: 109,428,244	V327A	probably benign	Het
Wdr20rt	A	T	12: 65,227,314	D344V	probably damaging	Het
Zfp940	A	G	7: 29,844,938	C515R	probably damaging	Het

Other mutations in Rpgrip1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00333:Rpgrip1	APN	14	52150438	splice site	probably null
IGL01016:Rpgrip1	APN	14	52145836	missense	probably damaging	1.00
IGL01019:Rpgrip1	APN	14	52131176	missense	possibly damaging	0.70
IGL01382:Rpgrip1	APN	14	52145477	missense	possibly damaging	0.93
IGL01433:Rpgrip1	APN	14	52126377	missense	probably damaging	1.00
IGL01528:Rpgrip1	APN	14	52112177	nonsense	probably null
IGL01548:Rpgrip1	APN	14	52126271	splice site	probably benign
IGL01652:Rpgrip1	APN	14	52145492	unclassified	probably benign
IGL02040:Rpgrip1	APN	14	52121019	missense	possibly damaging	0.86
IGL02113:Rpgrip1	APN	14	52133844	missense	possibly damaging	0.85
IGL02121:Rpgrip1	APN	14	52147374	missense	possibly damaging	0.89
IGL02185:Rpgrip1	APN	14	52112228	missense	possibly damaging	0.72
IGL02234:Rpgrip1	APN	14	52131309	splice site	probably benign
IGL02322:Rpgrip1	APN	14	52150042	missense	possibly damaging	0.89
IGL02379:Rpgrip1	APN	14	52138888	missense	possibly damaging	0.53
IGL02524:Rpgrip1	APN	14	52121054	missense	probably benign	0.01
IGL02836:Rpgrip1	APN	14	52145257	splice site	probably null
IGL03264:Rpgrip1	APN	14	52140652	missense	possibly damaging	0.53
IGL03410:Rpgrip1	APN	14	52158366	unclassified	probably benign
FR4976:Rpgrip1	UTSW	14	52149394	utr 3 prime	probably benign
FR4976:Rpgrip1	UTSW	14	52149544	utr 3 prime	probably benign
R0045:Rpgrip1	UTSW	14	52141144	missense	possibly damaging	0.53
R0045:Rpgrip1	UTSW	14	52141144	missense	possibly damaging	0.53
R0089:Rpgrip1	UTSW	14	52149384	utr 3 prime	probably benign
R0498:Rpgrip1	UTSW	14	52131314	splice site	probably benign
R0602:Rpgrip1	UTSW	14	52133856	missense	possibly damaging	0.72
R0776:Rpgrip1	UTSW	14	52141169	missense	possibly damaging	0.85
R1139:Rpgrip1	UTSW	14	52147221	missense	probably benign	0.33
R1528:Rpgrip1	UTSW	14	52112224	missense	probably benign	0.01
R1934:Rpgrip1	UTSW	14	52114644	missense	possibly damaging	0.53
R2087:Rpgrip1	UTSW	14	52136622	splice site	probably null
R2114:Rpgrip1	UTSW	14	52149567	missense	probably benign	0.27
R3406:Rpgrip1	UTSW	14	52145209	missense	possibly damaging	0.92
R3835:Rpgrip1	UTSW	14	52147253	missense	probably damaging	1.00
R4084:Rpgrip1	UTSW	14	52149351	missense	possibly damaging	0.72
R4124:Rpgrip1	UTSW	14	52152324	splice site	probably null
R4381:Rpgrip1	UTSW	14	52150449	missense	possibly damaging	0.54
R4407:Rpgrip1	UTSW	14	52147399	missense	probably damaging	1.00
R4520:Rpgrip1	UTSW	14	52152289	missense	probably benign	0.08
R4904:Rpgrip1	UTSW	14	52121087	missense	possibly damaging	0.86
R4904:Rpgrip1	UTSW	14	52160129	missense	probably damaging	0.97
R5284:Rpgrip1	UTSW	14	52149276	missense	probably damaging	1.00
R5342:Rpgrip1	UTSW	14	52145209	missense	possibly damaging	0.92
R5377:Rpgrip1	UTSW	14	52160195	missense	possibly damaging	0.96
R5499:Rpgrip1	UTSW	14	52140585	missense	probably benign	0.00
R5729:Rpgrip1	UTSW	14	52160160	missense	probably benign	0.28
R5834:Rpgrip1	UTSW	14	52158382	missense	probably damaging	0.99
R6157:Rpgrip1	UTSW	14	52112174	missense	probably benign	0.00
R6455:Rpgrip1	UTSW	14	52141189	missense	probably damaging	0.97
R6796:Rpgrip1	UTSW	14	52150012	missense	probably damaging	1.00
R7065:Rpgrip1	UTSW	14	52141193	missense	possibly damaging	0.96
R7173:Rpgrip1	UTSW	14	52112176	missense	possibly damaging	0.59
R7302:Rpgrip1	UTSW	14	52149555	missense	unknown
R7315:Rpgrip1	UTSW	14	52121001	missense	not run
R7320:Rpgrip1	UTSW	14	52131216	missense	possibly damaging	0.53
R7344:Rpgrip1	UTSW	14	52140659	missense	probably damaging	0.98
R7459:Rpgrip1	UTSW	14	52140559	missense	probably benign	0.18
R7797:Rpgrip1	UTSW	14	52133820	missense	possibly damaging	0.53
R7852:Rpgrip1	UTSW	14	52145880	missense	probably benign	0.01
R7916:Rpgrip1	UTSW	14	52131184	missense	possibly damaging	0.53
R7990:Rpgrip1	UTSW	14	52129518	missense	possibly damaging	0.53
R8041:Rpgrip1	UTSW	14	52119245	missense	possibly damaging	0.53
R8344:Rpgrip1	UTSW	14	52150362	missense	possibly damaging	0.62
R8403:Rpgrip1	UTSW	14	52152201	critical splice acceptor site	probably null
R8559:Rpgrip1	UTSW	14	52149257	missense	unknown
R8679:Rpgrip1	UTSW	14	52159395	missense	probably damaging	1.00
R8817:Rpgrip1	UTSW	14	52140599	missense	probably benign	0.33
R8890:Rpgrip1	UTSW	14	52145044	missense	possibly damaging	0.85
R9197:Rpgrip1	UTSW	14	52145400	missense	possibly damaging	0.51
RF028:Rpgrip1	UTSW	14	52149398	nonsense	probably null
RF034:Rpgrip1	UTSW	14	52149526	utr 3 prime	probably benign
RF035:Rpgrip1	UTSW	14	52149393	utr 3 prime	probably benign
RF036:Rpgrip1	UTSW	14	52149541	frame shift	probably null
RF040:Rpgrip1	UTSW	14	52149537	frame shift	probably null
RF043:Rpgrip1	UTSW	14	52149395	utr 3 prime	probably benign
X0024:Rpgrip1	UTSW	14	52141208	missense	possibly damaging	0.85
X0026:Rpgrip1	UTSW	14	52147221	missense	probably benign	0.33

Predicted Primers

PCR Primer
(F):5'- GCGTTTTACAACTCTCACCAACCG -3'
(R):5'- GCTCAGGCTTTCTAAGACCCTTCAC -3'

Sequencing Primer
(F):5'- TCACCAACCGCTTTTACCAATG -3'
(R):5'- ACCCAGAAGTTTGGCACTTG -3'

Posted On

2014-05-14