Incidental Mutation 'R1715:Cyp2c38'
ID 190971
Institutional Source Beutler Lab
Gene Symbol Cyp2c38
Ensembl Gene ENSMUSG00000032808
Gene Name cytochrome P450, family 2, subfamily c, polypeptide 38
MMRRC Submission 039748-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock # R1715 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 39389556-39463075 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 39404795 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 276 (H276R)
Ref Sequence ENSEMBL: ENSMUSP00000044722 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035488]
AlphaFold P56655
Predicted Effect probably benign
Transcript: ENSMUST00000035488
AA Change: H276R

PolyPhen 2 Score 0.248 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000044722
Gene: ENSMUSG00000032808
AA Change: H276R

signal peptide 1 20 N/A INTRINSIC
Pfam:p450 30 487 1.5e-161 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700023F06Rik T C 11: 103,199,824 probably null Het
2210010C04Rik A G 6: 41,032,936 probably null Het
2410089E03Rik T A 15: 8,226,900 probably null Het
Abca8a G A 11: 110,091,580 T12M probably damaging Het
Alms1 T A 6: 85,629,052 Y2561* probably null Het
Atp10a G A 7: 58,786,505 V348I probably damaging Het
Best2 T C 8: 85,011,223 Y181C probably benign Het
Btaf1 T A 19: 36,969,121 D442E probably damaging Het
C330027C09Rik C T 16: 49,005,719 T383I probably benign Het
Carmil3 T G 14: 55,504,532 V1153G probably benign Het
Cc2d2a A G 5: 43,718,661 I993M probably damaging Het
Ccng1 G A 11: 40,752,114 P169S probably benign Het
Cmtr2 T C 8: 110,222,798 L580P probably damaging Het
Col22a1 T C 15: 72,006,981 E109G possibly damaging Het
Crispld2 G T 8: 120,023,649 W264L possibly damaging Het
Dag1 A T 9: 108,208,715 V409E possibly damaging Het
Emc8 T C 8: 120,658,555 N146S probably benign Het
Glt8d1 T C 14: 31,011,521 V321A possibly damaging Het
Gm5174 C T 10: 86,656,912 noncoding transcript Het
Hdac10 G T 15: 89,126,709 probably null Het
Hectd4 A G 5: 121,344,818 D3144G possibly damaging Het
Ifna11 C T 4: 88,820,236 S93L probably damaging Het
Il16 T C 7: 83,648,728 N431S probably benign Het
Irf8 A T 8: 120,754,388 E237V probably damaging Het
Lrp1b A G 2: 41,185,981 Y1769H probably damaging Het
Lrrc9 A G 12: 72,477,299 N761D probably damaging Het
Mbtps1 T C 8: 119,542,730 Y207C probably benign Het
Myo9a A G 9: 59,832,300 E765G probably damaging Het
Nlrp3 A G 11: 59,543,351 D80G probably damaging Het
Olfr361 G A 2: 37,085,176 P191S probably damaging Het
Olfr697 G C 7: 106,741,548 P129A probably damaging Het
Olfr830 A T 9: 18,875,794 I156F probably benign Het
Pcyt2 T A 11: 120,615,851 probably null Het
Plxnd1 T C 6: 115,968,681 T944A probably benign Het
Psd4 A T 2: 24,405,332 I833F probably damaging Het
Psmd7 A G 8: 107,581,185 I222T probably benign Het
Rap2b A G 3: 61,365,190 E45G probably damaging Het
Rbm22 T C 18: 60,560,844 S7P possibly damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Rfx4 A G 10: 84,844,280 N107S probably damaging Het
Ripk2 T A 4: 16,155,192 probably null Het
Rpgrip1 T A 14: 52,140,691 C499S possibly damaging Het
Scarf1 T C 11: 75,524,044 S515P probably damaging Het
Sgip1 T C 4: 102,915,059 V215A probably benign Het
Sis T C 3: 72,889,010 I1813V possibly damaging Het
Slc17a3 A T 13: 23,856,741 T317S probably benign Het
Slc35e1 T C 8: 72,483,977 N340S probably benign Het
Smg6 A G 11: 74,929,430 I176V probably benign Het
Smim17 T C 7: 6,429,326 L89S probably damaging Het
Synm T C 7: 67,736,303 N95S probably damaging Het
Tdrd9 A G 12: 112,036,439 K841E possibly damaging Het
Tep1 G T 14: 50,854,567 F570L possibly damaging Het
Tgm3 G A 2: 130,026,814 probably null Het
Tra2b T C 16: 22,252,746 Y128C possibly damaging Het
Vmn2r17 T C 5: 109,428,244 V327A probably benign Het
Wdr20rt A T 12: 65,227,314 D344V probably damaging Het
Zfp940 A G 7: 29,844,938 C515R probably damaging Het
Other mutations in Cyp2c38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Cyp2c38 APN 19 39460725 nonsense probably null
IGL01109:Cyp2c38 APN 19 39462885 critical splice donor site probably null
IGL01521:Cyp2c38 APN 19 39460670 missense probably damaging 0.99
IGL02036:Cyp2c38 APN 19 39460316 missense probably null 0.97
IGL02187:Cyp2c38 APN 19 39436205 missense probably benign 0.14
IGL02954:Cyp2c38 APN 19 39391076 missense probably damaging 0.99
R0479:Cyp2c38 UTSW 19 39463005 missense probably damaging 0.99
R0684:Cyp2c38 UTSW 19 39391056 missense probably damaging 0.99
R0919:Cyp2c38 UTSW 19 39404669 missense probably benign 0.07
R1462:Cyp2c38 UTSW 19 39392188 missense probably damaging 0.96
R1462:Cyp2c38 UTSW 19 39392188 missense probably damaging 0.96
R1642:Cyp2c38 UTSW 19 39401709 missense probably damaging 1.00
R1900:Cyp2c38 UTSW 19 39438312 missense probably benign 0.40
R1954:Cyp2c38 UTSW 19 39404687 missense probably damaging 0.99
R1955:Cyp2c38 UTSW 19 39404687 missense probably damaging 0.99
R2860:Cyp2c38 UTSW 19 39460694 missense probably benign 0.01
R2861:Cyp2c38 UTSW 19 39460694 missense probably benign 0.01
R2862:Cyp2c38 UTSW 19 39460694 missense probably benign 0.01
R3084:Cyp2c38 UTSW 19 39401701 missense probably benign 0.00
R3727:Cyp2c38 UTSW 19 39392295 splice site probably benign
R4648:Cyp2c38 UTSW 19 39460688 missense probably benign 0.05
R5119:Cyp2c38 UTSW 19 39460621 missense probably damaging 1.00
R5636:Cyp2c38 UTSW 19 39438306 nonsense probably null
R5651:Cyp2c38 UTSW 19 39460712 missense probably damaging 0.99
R6263:Cyp2c38 UTSW 19 39392215 missense probably damaging 1.00
R6384:Cyp2c38 UTSW 19 39392293 splice site probably null
R6853:Cyp2c38 UTSW 19 39438304 missense probably benign 0.02
R6915:Cyp2c38 UTSW 19 39436068 missense probably damaging 0.99
R7201:Cyp2c38 UTSW 19 39401776 missense probably damaging 1.00
R7570:Cyp2c38 UTSW 19 39404743 missense possibly damaging 0.76
R7625:Cyp2c38 UTSW 19 39462924 missense possibly damaging 0.78
R7666:Cyp2c38 UTSW 19 39438242 missense possibly damaging 0.52
R8681:Cyp2c38 UTSW 19 39401691 missense possibly damaging 0.70
Predicted Primers PCR Primer
(R):5'- ttctgggctaataAGGGGCAAAGAATC -3'

Sequencing Primer
Posted On 2014-05-14