Incidental Mutation 'R1716:Cd46'
ID190981
Institutional Source Beutler Lab
Gene Symbol Cd46
Ensembl Gene ENSMUSG00000016493
Gene NameCD46 antigen, complement regulatory protein
SynonymsCD46, Mcp
MMRRC Submission 039749-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1716 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location195036826-195092249 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 195077809 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 245 (Q245L)
Ref Sequence ENSEMBL: ENSMUSP00000123901 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159563] [ENSMUST00000162650]
Predicted Effect probably benign
Transcript: ENSMUST00000159563
AA Change: Q245L

PolyPhen 2 Score 0.208 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000123901
Gene: ENSMUSG00000016493
AA Change: Q245L

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
CCP 45 104 6.7e-3 SMART
CCP 109 168 3.87e-8 SMART
CCP 173 234 2.14e-10 SMART
CCP 239 294 1.06e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162650
AA Change: Q245L

PolyPhen 2 Score 0.114 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000123931
Gene: ENSMUSG00000016493
AA Change: Q245L

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
CCP 45 104 6.7e-3 SMART
CCP 109 168 3.87e-8 SMART
CCP 173 234 2.14e-10 SMART
CCP 239 294 1.06e-14 SMART
transmembrane domain 328 350 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162951
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195553
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type I membrane protein and is a regulatory part of the complement system. The encoded protein has cofactor activity for inactivation of complement components C3b and C4b by serum factor I, which protects the host cell from damage by complement. In addition, the encoded protein can act as a receptor for the Edmonston strain of measles virus, human herpesvirus-6, and type IV pili of pathogenic Neisseria. Finally, the protein encoded by this gene may be involved in the fusion of the spermatozoa with the oocyte during fertilization. Mutations at this locus have been associated with susceptibility to hemolytic uremic syndrome. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jun 2010]
PHENOTYPE: Homozygous mutation of this gene results in increased litter sizes sired by mutant males. Another homozygous null mouse shows increased susceptibility to induced choroid neovascularization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 79,082,198 T2A unknown Het
Adgrf3 T A 5: 30,197,551 Q493L probably benign Het
Ak6 T C 13: 100,655,669 S207P probably benign Het
Ang A G 14: 51,101,480 D26G probably benign Het
Ang T C 14: 51,101,500 F33L probably damaging Het
Arhgef38 T A 3: 133,140,837 Y389F probably benign Het
Arhgef7 C A 8: 11,808,713 probably null Het
Bicd2 C A 13: 49,378,310 H343N probably benign Het
Casp4 G A 9: 5,308,919 probably null Het
Cd22 A G 7: 30,877,678 F68S probably damaging Het
Cntnap2 A T 6: 47,107,892 R1096* probably null Het
Cntnap3 A G 13: 64,762,002 V763A probably damaging Het
Cyp3a11 T C 5: 145,868,966 T171A probably benign Het
Defa30 A G 8: 21,135,415 Y65C probably damaging Het
Defb18 A T 1: 18,236,651 M27K probably benign Het
Dnah17 A G 11: 118,032,598 S4071P probably benign Het
Dnah7b T A 1: 46,191,783 D1400E probably damaging Het
Dpysl5 C T 5: 30,777,994 T147I probably benign Het
Dsg4 C T 18: 20,462,461 R574* probably null Het
Epm2a A G 10: 11,448,836 E223G probably benign Het
Etl4 T C 2: 20,743,681 S75P probably damaging Het
Fam189a1 A T 7: 64,776,885 probably null Het
Fbxw15 T A 9: 109,557,136 M312L probably benign Het
Fcgr4 C T 1: 171,020,103 T90I probably damaging Het
Fras1 T A 5: 96,552,725 D201E probably benign Het
Gadl1 A T 9: 116,006,508 K335* probably null Het
Gcsam T G 16: 45,619,993 V133G probably damaging Het
Gml G T 15: 74,813,816 L107I possibly damaging Het
Golga2 T A 2: 32,302,897 L409Q probably damaging Het
Gtf2a1l A T 17: 88,694,580 Q241L probably benign Het
Gtf3c3 A G 1: 54,399,260 Y799H probably damaging Het
Guca1b T G 17: 47,391,201 probably benign Het
Igdcc4 C A 9: 65,126,897 H617Q probably damaging Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Itga2b A C 11: 102,460,777 I574S probably benign Het
Kcnk7 A T 19: 5,706,831 I283F probably damaging Het
Kirrel3 T A 9: 35,023,547 L450M probably damaging Het
Lmntd1 A T 6: 145,419,874 S176R probably damaging Het
Lrrc39 C T 3: 116,579,567 T292I probably benign Het
Ltbp1 A T 17: 75,315,024 H801L probably benign Het
Macf1 T A 4: 123,401,403 Q3318L probably damaging Het
Man1b1 T A 2: 25,345,020 N282K probably benign Het
Map2k6 A T 11: 110,497,901 E223V probably damaging Het
Marf1 C A 16: 14,142,586 R531S possibly damaging Het
Mfge8 G A 7: 79,142,443 R245C probably damaging Het
Mgea5 C A 19: 45,752,174 K907N probably benign Het
Mogat1 T G 1: 78,538,044 N318K probably benign Het
Myh4 T A 11: 67,250,309 S732R possibly damaging Het
Myt1l T A 12: 29,811,538 D106E unknown Het
Ndc1 T C 4: 107,384,795 F302L probably damaging Het
Ndrg4 C T 8: 95,712,328 A290V probably benign Het
Nfia A T 4: 98,063,128 K397N probably damaging Het
Nlrp4e A T 7: 23,321,033 Q315L possibly damaging Het
Olfr51 T A 11: 51,007,852 N293K probably damaging Het
Olfr9 A C 10: 128,990,852 *313C probably null Het
Peg3 T C 7: 6,707,781 I1481V possibly damaging Het
Phldb2 C T 16: 45,775,050 G883D probably benign Het
Pik3c2b T A 1: 133,094,826 Y1169N probably damaging Het
Plcl1 A T 1: 55,695,838 I113F probably damaging Het
Pomt2 T C 12: 87,124,836 I457V probably benign Het
Ppil1 T C 17: 29,261,835 N38S possibly damaging Het
Prf1 A G 10: 61,300,452 N169S probably benign Het
Prmt8 A C 6: 127,726,523 probably null Het
Ptprg T A 14: 12,154,360 S694T probably benign Het
Rab12 A T 17: 66,500,320 M138K possibly damaging Het
Reln T C 5: 21,955,095 T2159A probably damaging Het
Retsat A T 6: 72,606,080 Y36F probably damaging Het
Rgs14 A T 13: 55,378,883 Q116L probably damaging Het
Rlbp1 A T 7: 79,375,936 N252K probably damaging Het
Rtraf A G 14: 19,812,174 L215P probably damaging Het
Sec1 A T 7: 45,679,365 M86K probably benign Het
Sec24b A T 3: 130,041,016 S42T possibly damaging Het
Serpinb9d T C 13: 33,196,517 S129P probably damaging Het
Slc35f5 T G 1: 125,584,532 D356E possibly damaging Het
Smpd4 T C 16: 17,642,501 S694P probably damaging Het
Spag6 G T 2: 18,745,609 probably null Het
Spata31d1c T C 13: 65,033,216 I43T possibly damaging Het
Ssh1 T C 5: 113,952,020 D314G possibly damaging Het
Tnfrsf17 G A 16: 11,319,731 D111N probably benign Het
Ttn A G 2: 76,723,291 I30994T probably damaging Het
Ttn A T 2: 76,783,976 F8737L probably damaging Het
Ush1c G T 7: 46,195,728 F890L probably benign Het
Usp36 C T 11: 118,272,131 probably null Het
Vmn2r115 T C 17: 23,347,821 Y436H probably benign Het
Vmn2r94 T A 17: 18,257,373 M259L probably benign Het
Wwp1 T C 4: 19,659,698 T197A probably benign Het
Zbtb37 T A 1: 161,020,244 M398L probably benign Het
Zfp804b C T 5: 6,769,673 C1130Y probably benign Het
Zfp9 A G 6: 118,464,751 C317R probably damaging Het
Zscan20 T C 4: 128,586,541 H719R probably damaging Het
Other mutations in Cd46
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02429:Cd46 APN 1 195085424 missense probably benign 0.01
IGL03029:Cd46 APN 1 195086143 missense probably benign 0.43
R0269:Cd46 UTSW 1 195064688 missense probably benign 0.00
R0375:Cd46 UTSW 1 195086164 missense probably benign 0.00
R0627:Cd46 UTSW 1 195092186 missense probably benign 0.03
R0784:Cd46 UTSW 1 195092194 missense possibly damaging 0.96
R0892:Cd46 UTSW 1 195082612 missense possibly damaging 0.78
R0973:Cd46 UTSW 1 195041992 makesense probably null
R0973:Cd46 UTSW 1 195041992 makesense probably null
R0974:Cd46 UTSW 1 195041992 makesense probably null
R1224:Cd46 UTSW 1 195062398 missense possibly damaging 0.66
R1863:Cd46 UTSW 1 195083623 missense probably damaging 1.00
R2000:Cd46 UTSW 1 195077704 missense probably benign 0.00
R2152:Cd46 UTSW 1 195062413 missense probably benign 0.42
R2153:Cd46 UTSW 1 195062413 missense probably benign 0.42
R4452:Cd46 UTSW 1 195085360 missense possibly damaging 0.84
R4860:Cd46 UTSW 1 195062396 missense possibly damaging 0.94
R4860:Cd46 UTSW 1 195062396 missense possibly damaging 0.94
R4934:Cd46 UTSW 1 195082799 intron probably benign
R5156:Cd46 UTSW 1 195085385 missense possibly damaging 0.90
R5287:Cd46 UTSW 1 195062411 missense possibly damaging 0.65
R5303:Cd46 UTSW 1 195062399 missense probably benign
R5403:Cd46 UTSW 1 195062411 missense possibly damaging 0.65
R5487:Cd46 UTSW 1 195068170 critical splice acceptor site probably null
R5505:Cd46 UTSW 1 195085380 missense possibly damaging 0.88
R5538:Cd46 UTSW 1 195068170 critical splice acceptor site probably null
R6721:Cd46 UTSW 1 195083631 missense probably damaging 1.00
R6731:Cd46 UTSW 1 195083467 splice site probably null
R7226:Cd46 UTSW 1 195042006 missense possibly damaging 0.84
R7633:Cd46 UTSW 1 195083619 missense probably null 0.01
R8277:Cd46 UTSW 1 195064722 missense probably damaging 0.96
R8672:Cd46 UTSW 1 195082641 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CTGAAAGCTTGCTGCATCCTCTTACTAT -3'
(R):5'- TCCACAGTGCCTAGCCTAGCAAT -3'

Sequencing Primer
(F):5'- gtgctcttaatcactaagccatc -3'
(R):5'- TGGAAAATACCCTGTGTACTGG -3'
Posted On2014-05-14