Incidental Mutation 'R1716:Zscan20'
ID190995
Institutional Source Beutler Lab
Gene Symbol Zscan20
Ensembl Gene ENSMUSG00000061894
Gene Namezinc finger and SCAN domains 20
SynonymsZfp31
MMRRC Submission 039749-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.242) question?
Stock #R1716 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location128583539-128610098 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 128586541 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 719 (H719R)
Ref Sequence ENSEMBL: ENSMUSP00000095487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097877] [ENSMUST00000135309]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000084276
Predicted Effect probably damaging
Transcript: ENSMUST00000097877
AA Change: H719R

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000095487
Gene: ENSMUSG00000061894
AA Change: H719R

DomainStartEndE-ValueType
SCAN 41 147 1.31e-54 SMART
low complexity region 275 284 N/A INTRINSIC
SANT 314 378 8.04e-1 SMART
SANT 475 539 4.85e-3 SMART
ZnF_C2H2 725 747 2.61e1 SMART
ZnF_C2H2 753 775 9.88e-5 SMART
ZnF_C2H2 781 803 1.12e-3 SMART
ZnF_C2H2 862 884 3.21e-4 SMART
ZnF_C2H2 890 912 1.04e-3 SMART
ZnF_C2H2 918 940 1.56e-2 SMART
ZnF_C2H2 946 968 2.84e-5 SMART
ZnF_C2H2 974 996 4.54e-4 SMART
ZnF_C2H2 1002 1024 1.47e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135309
SMART Domains Protein: ENSMUSP00000119338
Gene: ENSMUSG00000061894

DomainStartEndE-ValueType
SCAN 41 147 1.31e-54 SMART
low complexity region 279 293 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 79,082,198 T2A unknown Het
Adgrf3 T A 5: 30,197,551 Q493L probably benign Het
Ak6 T C 13: 100,655,669 S207P probably benign Het
Ang A G 14: 51,101,480 D26G probably benign Het
Ang T C 14: 51,101,500 F33L probably damaging Het
Arhgef38 T A 3: 133,140,837 Y389F probably benign Het
Arhgef7 C A 8: 11,808,713 probably null Het
Bicd2 C A 13: 49,378,310 H343N probably benign Het
Casp4 G A 9: 5,308,919 probably null Het
Cd22 A G 7: 30,877,678 F68S probably damaging Het
Cd46 T A 1: 195,077,809 Q245L probably benign Het
Cntnap2 A T 6: 47,107,892 R1096* probably null Het
Cntnap3 A G 13: 64,762,002 V763A probably damaging Het
Cyp3a11 T C 5: 145,868,966 T171A probably benign Het
Defa30 A G 8: 21,135,415 Y65C probably damaging Het
Defb18 A T 1: 18,236,651 M27K probably benign Het
Dnah17 A G 11: 118,032,598 S4071P probably benign Het
Dnah7b T A 1: 46,191,783 D1400E probably damaging Het
Dpysl5 C T 5: 30,777,994 T147I probably benign Het
Dsg4 C T 18: 20,462,461 R574* probably null Het
Epm2a A G 10: 11,448,836 E223G probably benign Het
Etl4 T C 2: 20,743,681 S75P probably damaging Het
Fam189a1 A T 7: 64,776,885 probably null Het
Fbxw15 T A 9: 109,557,136 M312L probably benign Het
Fcgr4 C T 1: 171,020,103 T90I probably damaging Het
Fras1 T A 5: 96,552,725 D201E probably benign Het
Gadl1 A T 9: 116,006,508 K335* probably null Het
Gcsam T G 16: 45,619,993 V133G probably damaging Het
Gml G T 15: 74,813,816 L107I possibly damaging Het
Golga2 T A 2: 32,302,897 L409Q probably damaging Het
Gtf2a1l A T 17: 88,694,580 Q241L probably benign Het
Gtf3c3 A G 1: 54,399,260 Y799H probably damaging Het
Guca1b T G 17: 47,391,201 probably benign Het
Igdcc4 C A 9: 65,126,897 H617Q probably damaging Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Itga2b A C 11: 102,460,777 I574S probably benign Het
Kcnk7 A T 19: 5,706,831 I283F probably damaging Het
Kirrel3 T A 9: 35,023,547 L450M probably damaging Het
Lmntd1 A T 6: 145,419,874 S176R probably damaging Het
Lrrc39 C T 3: 116,579,567 T292I probably benign Het
Ltbp1 A T 17: 75,315,024 H801L probably benign Het
Macf1 T A 4: 123,401,403 Q3318L probably damaging Het
Man1b1 T A 2: 25,345,020 N282K probably benign Het
Map2k6 A T 11: 110,497,901 E223V probably damaging Het
Marf1 C A 16: 14,142,586 R531S possibly damaging Het
Mfge8 G A 7: 79,142,443 R245C probably damaging Het
Mgea5 C A 19: 45,752,174 K907N probably benign Het
Mogat1 T G 1: 78,538,044 N318K probably benign Het
Myh4 T A 11: 67,250,309 S732R possibly damaging Het
Myt1l T A 12: 29,811,538 D106E unknown Het
Ndc1 T C 4: 107,384,795 F302L probably damaging Het
Ndrg4 C T 8: 95,712,328 A290V probably benign Het
Nfia A T 4: 98,063,128 K397N probably damaging Het
Nlrp4e A T 7: 23,321,033 Q315L possibly damaging Het
Olfr51 T A 11: 51,007,852 N293K probably damaging Het
Olfr9 A C 10: 128,990,852 *313C probably null Het
Peg3 T C 7: 6,707,781 I1481V possibly damaging Het
Phldb2 C T 16: 45,775,050 G883D probably benign Het
Pik3c2b T A 1: 133,094,826 Y1169N probably damaging Het
Plcl1 A T 1: 55,695,838 I113F probably damaging Het
Pomt2 T C 12: 87,124,836 I457V probably benign Het
Ppil1 T C 17: 29,261,835 N38S possibly damaging Het
Prf1 A G 10: 61,300,452 N169S probably benign Het
Prmt8 A C 6: 127,726,523 probably null Het
Ptprg T A 14: 12,154,360 S694T probably benign Het
Rab12 A T 17: 66,500,320 M138K possibly damaging Het
Reln T C 5: 21,955,095 T2159A probably damaging Het
Retsat A T 6: 72,606,080 Y36F probably damaging Het
Rgs14 A T 13: 55,378,883 Q116L probably damaging Het
Rlbp1 A T 7: 79,375,936 N252K probably damaging Het
Rtraf A G 14: 19,812,174 L215P probably damaging Het
Sec1 A T 7: 45,679,365 M86K probably benign Het
Sec24b A T 3: 130,041,016 S42T possibly damaging Het
Serpinb9d T C 13: 33,196,517 S129P probably damaging Het
Slc35f5 T G 1: 125,584,532 D356E possibly damaging Het
Smpd4 T C 16: 17,642,501 S694P probably damaging Het
Spag6 G T 2: 18,745,609 probably null Het
Spata31d1c T C 13: 65,033,216 I43T possibly damaging Het
Ssh1 T C 5: 113,952,020 D314G possibly damaging Het
Tnfrsf17 G A 16: 11,319,731 D111N probably benign Het
Ttn A G 2: 76,723,291 I30994T probably damaging Het
Ttn A T 2: 76,783,976 F8737L probably damaging Het
Ush1c G T 7: 46,195,728 F890L probably benign Het
Usp36 C T 11: 118,272,131 probably null Het
Vmn2r115 T C 17: 23,347,821 Y436H probably benign Het
Vmn2r94 T A 17: 18,257,373 M259L probably benign Het
Wwp1 T C 4: 19,659,698 T197A probably benign Het
Zbtb37 T A 1: 161,020,244 M398L probably benign Het
Zfp804b C T 5: 6,769,673 C1130Y probably benign Het
Zfp9 A G 6: 118,464,751 C317R probably damaging Het
Other mutations in Zscan20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Zscan20 APN 4 128586635 missense probably damaging 0.99
IGL01454:Zscan20 APN 4 128589541 missense probably benign 0.01
IGL01934:Zscan20 APN 4 128592484 missense possibly damaging 0.94
IGL02288:Zscan20 APN 4 128586643 missense probably damaging 1.00
IGL02336:Zscan20 APN 4 128585794 missense probably damaging 1.00
IGL02385:Zscan20 APN 4 128604599 missense possibly damaging 0.66
IGL02437:Zscan20 APN 4 128588417 missense probably damaging 1.00
IGL02450:Zscan20 APN 4 128586657 missense probably damaging 0.99
R0034:Zscan20 UTSW 4 128585662 missense probably damaging 0.96
R0034:Zscan20 UTSW 4 128585662 missense probably damaging 0.96
R0070:Zscan20 UTSW 4 128585882 missense possibly damaging 0.73
R0142:Zscan20 UTSW 4 128585837 missense probably benign 0.38
R0496:Zscan20 UTSW 4 128591889 missense probably benign 0.42
R0567:Zscan20 UTSW 4 128589450 critical splice donor site probably null
R1333:Zscan20 UTSW 4 128588096 missense possibly damaging 0.61
R2302:Zscan20 UTSW 4 128588264 missense probably damaging 1.00
R3870:Zscan20 UTSW 4 128586425 missense probably damaging 1.00
R4611:Zscan20 UTSW 4 128588106 missense probably benign 0.00
R4884:Zscan20 UTSW 4 128588165 missense possibly damaging 0.56
R4972:Zscan20 UTSW 4 128592359 missense probably benign 0.39
R5033:Zscan20 UTSW 4 128586128 missense probably benign 0.01
R5160:Zscan20 UTSW 4 128592482 missense possibly damaging 0.69
R5182:Zscan20 UTSW 4 128586711 missense possibly damaging 0.71
R5214:Zscan20 UTSW 4 128588316 missense probably benign 0.00
R5345:Zscan20 UTSW 4 128588121 missense probably benign 0.04
R5863:Zscan20 UTSW 4 128586348 nonsense probably null
R6217:Zscan20 UTSW 4 128604534 missense probably damaging 1.00
R6597:Zscan20 UTSW 4 128585746 missense probably damaging 0.96
R6751:Zscan20 UTSW 4 128585875 missense probably damaging 1.00
R6852:Zscan20 UTSW 4 128589722 missense probably damaging 1.00
R7172:Zscan20 UTSW 4 128585676 nonsense probably null
R7338:Zscan20 UTSW 4 128588150 missense probably benign
R7805:Zscan20 UTSW 4 128585806 missense probably damaging 1.00
R8063:Zscan20 UTSW 4 128586235 missense probably benign 0.01
R8244:Zscan20 UTSW 4 128585966 missense probably benign 0.32
R8421:Zscan20 UTSW 4 128585827 missense probably damaging 1.00
R8752:Zscan20 UTSW 4 128585687 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCTTAGAGAAGCACCTTCCACAC -3'
(R):5'- AGATATACCACCAAAGCCGTTTGCC -3'

Sequencing Primer
(F):5'- gggcttttcccctgtgtg -3'
(R):5'- TGCCAGCCTTGTGACTG -3'
Posted On2014-05-14