Incidental Mutation 'R1716:Dpysl5'
ID 190999
Institutional Source Beutler Lab
Gene Symbol Dpysl5
Ensembl Gene ENSMUSG00000029168
Gene Name dihydropyrimidinase-like 5
Synonyms CRMP-5, Crmp5, CRAM
MMRRC Submission 039749-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.234) question?
Stock # R1716 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 30868908-30956713 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 30935338 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 147 (T147I)
Ref Sequence ENSEMBL: ENSMUSP00000110377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088081] [ENSMUST00000114729]
AlphaFold Q9EQF6
Predicted Effect probably benign
Transcript: ENSMUST00000088081
AA Change: T147I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000085400
Gene: ENSMUSG00000029168
AA Change: T147I

DomainStartEndE-ValueType
Pfam:Amidohydro_5 28 97 3.4e-11 PFAM
Pfam:Amidohydro_4 52 403 4.3e-17 PFAM
Pfam:Amidohydro_1 57 406 2.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114729
AA Change: T147I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000110377
Gene: ENSMUSG00000029168
AA Change: T147I

DomainStartEndE-ValueType
Pfam:Amidohydro_1 57 446 1.1e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127365
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the CRMP (collapsing response mediator protein) family thought to be involved in neural development. Antibodies to the encoded protein were found in some patients with neurologic symptoms who had paraneoplastic syndrome. A pseudogene of this gene is found on chromosome 11. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit limb grasping, abnormal Purkinje morphology, absent long term depression, and no response to BDNF. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 78,731,946 (GRCm39) T2A unknown Het
Adgrf3 T A 5: 30,402,549 (GRCm39) Q493L probably benign Het
Ak6 T C 13: 100,792,177 (GRCm39) S207P probably benign Het
Ang A G 14: 51,338,937 (GRCm39) D26G probably benign Het
Ang T C 14: 51,338,957 (GRCm39) F33L probably damaging Het
Arhgef38 T A 3: 132,846,598 (GRCm39) Y389F probably benign Het
Arhgef7 C A 8: 11,858,713 (GRCm39) probably null Het
Bicd2 C A 13: 49,531,786 (GRCm39) H343N probably benign Het
Casp4 G A 9: 5,308,919 (GRCm39) probably null Het
Cd22 A G 7: 30,577,103 (GRCm39) F68S probably damaging Het
Cd46 T A 1: 194,760,117 (GRCm39) Q245L probably benign Het
Cntnap2 A T 6: 47,084,826 (GRCm39) R1096* probably null Het
Cntnap3 A G 13: 64,909,816 (GRCm39) V763A probably damaging Het
Cyp3a11 T C 5: 145,805,776 (GRCm39) T171A probably benign Het
Defa30 A G 8: 21,625,431 (GRCm39) Y65C probably damaging Het
Defb18 A T 1: 18,306,875 (GRCm39) M27K probably benign Het
Dnah17 A G 11: 117,923,424 (GRCm39) S4071P probably benign Het
Dnah7b T A 1: 46,230,943 (GRCm39) D1400E probably damaging Het
Dsg4 C T 18: 20,595,518 (GRCm39) R574* probably null Het
Entrep2 A T 7: 64,426,633 (GRCm39) probably null Het
Epm2a A G 10: 11,324,580 (GRCm39) E223G probably benign Het
Etl4 T C 2: 20,748,492 (GRCm39) S75P probably damaging Het
Fbxw15 T A 9: 109,386,204 (GRCm39) M312L probably benign Het
Fcgr4 C T 1: 170,847,672 (GRCm39) T90I probably damaging Het
Fras1 T A 5: 96,700,584 (GRCm39) D201E probably benign Het
Gadl1 A T 9: 115,835,576 (GRCm39) K335* probably null Het
Gcsam T G 16: 45,440,356 (GRCm39) V133G probably damaging Het
Gml G T 15: 74,685,665 (GRCm39) L107I possibly damaging Het
Golga2 T A 2: 32,192,909 (GRCm39) L409Q probably damaging Het
Gtf2a1l A T 17: 89,002,008 (GRCm39) Q241L probably benign Het
Gtf3c3 A G 1: 54,438,419 (GRCm39) Y799H probably damaging Het
Guca1b T G 17: 47,702,126 (GRCm39) probably benign Het
Igdcc4 C A 9: 65,034,179 (GRCm39) H617Q probably damaging Het
Ip6k1 G A 9: 107,918,195 (GRCm39) E77K possibly damaging Het
Itga2b A C 11: 102,351,603 (GRCm39) I574S probably benign Het
Kcnk7 A T 19: 5,756,859 (GRCm39) I283F probably damaging Het
Kirrel3 T A 9: 34,934,843 (GRCm39) L450M probably damaging Het
Lmntd1 A T 6: 145,365,600 (GRCm39) S176R probably damaging Het
Lrrc39 C T 3: 116,373,216 (GRCm39) T292I probably benign Het
Ltbp1 A T 17: 75,622,019 (GRCm39) H801L probably benign Het
Macf1 T A 4: 123,295,196 (GRCm39) Q3318L probably damaging Het
Man1b1 T A 2: 25,235,032 (GRCm39) N282K probably benign Het
Map2k6 A T 11: 110,388,727 (GRCm39) E223V probably damaging Het
Marf1 C A 16: 13,960,450 (GRCm39) R531S possibly damaging Het
Mfge8 G A 7: 78,792,191 (GRCm39) R245C probably damaging Het
Mogat1 T G 1: 78,514,681 (GRCm39) N318K probably benign Het
Myh4 T A 11: 67,141,135 (GRCm39) S732R possibly damaging Het
Myt1l T A 12: 29,861,537 (GRCm39) D106E unknown Het
Ndc1 T C 4: 107,241,992 (GRCm39) F302L probably damaging Het
Ndrg4 C T 8: 96,438,956 (GRCm39) A290V probably benign Het
Nfia A T 4: 97,951,365 (GRCm39) K397N probably damaging Het
Nlrp4e A T 7: 23,020,458 (GRCm39) Q315L possibly damaging Het
Oga C A 19: 45,740,613 (GRCm39) K907N probably benign Het
Or10p22 A C 10: 128,826,721 (GRCm39) *313C probably null Het
Or1ad8 T A 11: 50,898,679 (GRCm39) N293K probably damaging Het
Peg3 T C 7: 6,710,780 (GRCm39) I1481V possibly damaging Het
Phldb2 C T 16: 45,595,413 (GRCm39) G883D probably benign Het
Pik3c2b T A 1: 133,022,564 (GRCm39) Y1169N probably damaging Het
Plcl1 A T 1: 55,734,997 (GRCm39) I113F probably damaging Het
Pomt2 T C 12: 87,171,610 (GRCm39) I457V probably benign Het
Ppil1 T C 17: 29,480,809 (GRCm39) N38S possibly damaging Het
Prf1 A G 10: 61,136,231 (GRCm39) N169S probably benign Het
Prmt8 A C 6: 127,703,486 (GRCm39) probably null Het
Ptprg T A 14: 12,154,360 (GRCm38) S694T probably benign Het
Rab12 A T 17: 66,807,315 (GRCm39) M138K possibly damaging Het
Reln T C 5: 22,160,093 (GRCm39) T2159A probably damaging Het
Retsat A T 6: 72,583,063 (GRCm39) Y36F probably damaging Het
Rgs14 A T 13: 55,526,696 (GRCm39) Q116L probably damaging Het
Rlbp1 A T 7: 79,025,684 (GRCm39) N252K probably damaging Het
Rtraf A G 14: 19,862,242 (GRCm39) L215P probably damaging Het
Sec1 A T 7: 45,328,789 (GRCm39) M86K probably benign Het
Sec24b A T 3: 129,834,665 (GRCm39) S42T possibly damaging Het
Serpinb9d T C 13: 33,380,500 (GRCm39) S129P probably damaging Het
Slc35f5 T G 1: 125,512,269 (GRCm39) D356E possibly damaging Het
Smpd4 T C 16: 17,460,365 (GRCm39) S694P probably damaging Het
Spag6 G T 2: 18,750,420 (GRCm39) probably null Het
Spata31d1c T C 13: 65,181,030 (GRCm39) I43T possibly damaging Het
Ssh1 T C 5: 114,090,081 (GRCm39) D314G possibly damaging Het
Tnfrsf17 G A 16: 11,137,595 (GRCm39) D111N probably benign Het
Ttn A G 2: 76,553,635 (GRCm39) I30994T probably damaging Het
Ttn A T 2: 76,614,320 (GRCm39) F8737L probably damaging Het
Ush1c G T 7: 45,845,152 (GRCm39) F890L probably benign Het
Usp36 C T 11: 118,162,957 (GRCm39) probably null Het
Vmn2r115 T C 17: 23,566,795 (GRCm39) Y436H probably benign Het
Vmn2r94 T A 17: 18,477,635 (GRCm39) M259L probably benign Het
Wwp1 T C 4: 19,659,698 (GRCm39) T197A probably benign Het
Zbtb37 T A 1: 160,847,814 (GRCm39) M398L probably benign Het
Zfp804b C T 5: 6,819,673 (GRCm39) C1130Y probably benign Het
Zfp9 A G 6: 118,441,712 (GRCm39) C317R probably damaging Het
Zscan20 T C 4: 128,480,334 (GRCm39) H719R probably damaging Het
Other mutations in Dpysl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02177:Dpysl5 APN 5 30,902,622 (GRCm39) missense probably damaging 1.00
IGL02277:Dpysl5 APN 5 30,946,125 (GRCm39) missense probably damaging 1.00
R0517:Dpysl5 UTSW 5 30,935,410 (GRCm39) missense probably damaging 0.99
R0788:Dpysl5 UTSW 5 30,946,185 (GRCm39) critical splice donor site probably null
R2016:Dpysl5 UTSW 5 30,948,941 (GRCm39) missense probably damaging 1.00
R2208:Dpysl5 UTSW 5 30,948,941 (GRCm39) missense probably damaging 1.00
R2211:Dpysl5 UTSW 5 30,948,941 (GRCm39) missense probably damaging 1.00
R2965:Dpysl5 UTSW 5 30,948,941 (GRCm39) missense probably damaging 1.00
R4440:Dpysl5 UTSW 5 30,949,612 (GRCm39) missense probably damaging 0.99
R4863:Dpysl5 UTSW 5 30,941,687 (GRCm39) missense probably benign 0.08
R4918:Dpysl5 UTSW 5 30,949,612 (GRCm39) missense probably damaging 1.00
R5377:Dpysl5 UTSW 5 30,948,857 (GRCm39) missense probably damaging 1.00
R6379:Dpysl5 UTSW 5 30,935,317 (GRCm39) critical splice acceptor site probably null
R6621:Dpysl5 UTSW 5 30,941,813 (GRCm39) critical splice donor site probably null
R7199:Dpysl5 UTSW 5 30,940,539 (GRCm39) missense probably benign 0.21
R7232:Dpysl5 UTSW 5 30,949,642 (GRCm39) missense probably benign 0.03
R7388:Dpysl5 UTSW 5 30,902,805 (GRCm39) missense probably benign
R7446:Dpysl5 UTSW 5 30,936,231 (GRCm39) missense probably benign 0.00
R7868:Dpysl5 UTSW 5 30,902,760 (GRCm39) missense probably damaging 1.00
R8041:Dpysl5 UTSW 5 30,953,658 (GRCm39) missense probably benign 0.28
R8428:Dpysl5 UTSW 5 30,902,811 (GRCm39) missense probably damaging 0.99
R8835:Dpysl5 UTSW 5 30,936,282 (GRCm39) critical splice donor site probably null
R8888:Dpysl5 UTSW 5 30,902,687 (GRCm39) missense probably benign 0.01
R8943:Dpysl5 UTSW 5 30,935,375 (GRCm39) missense probably benign 0.33
R9033:Dpysl5 UTSW 5 30,948,941 (GRCm39) missense probably damaging 1.00
R9139:Dpysl5 UTSW 5 30,935,397 (GRCm39) missense probably benign 0.45
R9305:Dpysl5 UTSW 5 30,948,959 (GRCm39) missense probably damaging 1.00
R9522:Dpysl5 UTSW 5 30,935,399 (GRCm39) nonsense probably null
R9700:Dpysl5 UTSW 5 30,904,417 (GRCm39) nonsense probably null
Z1176:Dpysl5 UTSW 5 30,935,464 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCCCACCTAAGAGCCCATTTCTCAG -3'
(R):5'- AGCTCTCCATTTTCAGCGTGGAC -3'

Sequencing Primer
(F):5'- GTTCACAGTGAGCATCAATTGC -3'
(R):5'- TTGGTACAGCTCACTGTCTC -3'
Posted On 2014-05-14