Incidental Mutation 'R1716:Cntnap2'
ID 191004
Institutional Source Beutler Lab
Gene Symbol Cntnap2
Ensembl Gene ENSMUSG00000039419
Gene Name contactin associated protein-like 2
Synonyms Caspr2, 5430425M22Rik
MMRRC Submission 039749-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1716 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 45036995-47278330 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 47084826 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 1096 (R1096*)
Ref Sequence ENSEMBL: ENSMUSP00000110288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114641]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000114641
AA Change: R1096*
SMART Domains Protein: ENSMUSP00000110288
Gene: ENSMUSG00000039419
AA Change: R1096*

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FA58C 34 181 3.99e-22 SMART
LamG 208 345 5.5e-34 SMART
LamG 393 529 3.31e-28 SMART
EGF 557 591 5.04e-2 SMART
Blast:FBG 594 777 7e-68 BLAST
LamG 819 945 5.58e-35 SMART
EGF 966 1002 2.11e1 SMART
LamG 1048 1188 3.55e-28 SMART
low complexity region 1263 1273 N/A INTRINSIC
4.1m 1283 1301 4.21e-7 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin family which functions in the vertebrate nervous system as cell adhesion molecules and receptors. This protein, like other neurexin proteins, contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, thrombospondin N-terminal-like domains and a putative PDZ binding site. This protein is localized at the juxtaparanodes of myelinated axons, and mediates interactions between neurons and glia during nervous system development and is also involved in localization of potassium channels within differentiating axons. This gene encompasses almost 1.5% of chromosome 7 and is one of the largest genes in the human genome. It is directly bound and regulated by forkhead box protein P2 (FOXP2), a transcription factor related to speech and language development. This gene has been implicated in multiple neurodevelopmental disorders, including Gilles de la Tourette syndrome, schizophrenia, epilepsy, autism, ADHD and mental retardation.[provided by RefSeq, Mar 2010]
PHENOTYPE: Inactivation of this gene results in molecular abnormalities within the central nervous system, but homozygous mutant mice show no overt phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 78,731,946 (GRCm39) T2A unknown Het
Adgrf3 T A 5: 30,402,549 (GRCm39) Q493L probably benign Het
Ak6 T C 13: 100,792,177 (GRCm39) S207P probably benign Het
Ang A G 14: 51,338,937 (GRCm39) D26G probably benign Het
Ang T C 14: 51,338,957 (GRCm39) F33L probably damaging Het
Arhgef38 T A 3: 132,846,598 (GRCm39) Y389F probably benign Het
Arhgef7 C A 8: 11,858,713 (GRCm39) probably null Het
Bicd2 C A 13: 49,531,786 (GRCm39) H343N probably benign Het
Casp4 G A 9: 5,308,919 (GRCm39) probably null Het
Cd22 A G 7: 30,577,103 (GRCm39) F68S probably damaging Het
Cd46 T A 1: 194,760,117 (GRCm39) Q245L probably benign Het
Cntnap3 A G 13: 64,909,816 (GRCm39) V763A probably damaging Het
Cyp3a11 T C 5: 145,805,776 (GRCm39) T171A probably benign Het
Defa30 A G 8: 21,625,431 (GRCm39) Y65C probably damaging Het
Defb18 A T 1: 18,306,875 (GRCm39) M27K probably benign Het
Dnah17 A G 11: 117,923,424 (GRCm39) S4071P probably benign Het
Dnah7b T A 1: 46,230,943 (GRCm39) D1400E probably damaging Het
Dpysl5 C T 5: 30,935,338 (GRCm39) T147I probably benign Het
Dsg4 C T 18: 20,595,518 (GRCm39) R574* probably null Het
Entrep2 A T 7: 64,426,633 (GRCm39) probably null Het
Epm2a A G 10: 11,324,580 (GRCm39) E223G probably benign Het
Etl4 T C 2: 20,748,492 (GRCm39) S75P probably damaging Het
Fbxw15 T A 9: 109,386,204 (GRCm39) M312L probably benign Het
Fcgr4 C T 1: 170,847,672 (GRCm39) T90I probably damaging Het
Fras1 T A 5: 96,700,584 (GRCm39) D201E probably benign Het
Gadl1 A T 9: 115,835,576 (GRCm39) K335* probably null Het
Gcsam T G 16: 45,440,356 (GRCm39) V133G probably damaging Het
Gml G T 15: 74,685,665 (GRCm39) L107I possibly damaging Het
Golga2 T A 2: 32,192,909 (GRCm39) L409Q probably damaging Het
Gtf2a1l A T 17: 89,002,008 (GRCm39) Q241L probably benign Het
Gtf3c3 A G 1: 54,438,419 (GRCm39) Y799H probably damaging Het
Guca1b T G 17: 47,702,126 (GRCm39) probably benign Het
Igdcc4 C A 9: 65,034,179 (GRCm39) H617Q probably damaging Het
Ip6k1 G A 9: 107,918,195 (GRCm39) E77K possibly damaging Het
Itga2b A C 11: 102,351,603 (GRCm39) I574S probably benign Het
Kcnk7 A T 19: 5,756,859 (GRCm39) I283F probably damaging Het
Kirrel3 T A 9: 34,934,843 (GRCm39) L450M probably damaging Het
Lmntd1 A T 6: 145,365,600 (GRCm39) S176R probably damaging Het
Lrrc39 C T 3: 116,373,216 (GRCm39) T292I probably benign Het
Ltbp1 A T 17: 75,622,019 (GRCm39) H801L probably benign Het
Macf1 T A 4: 123,295,196 (GRCm39) Q3318L probably damaging Het
Man1b1 T A 2: 25,235,032 (GRCm39) N282K probably benign Het
Map2k6 A T 11: 110,388,727 (GRCm39) E223V probably damaging Het
Marf1 C A 16: 13,960,450 (GRCm39) R531S possibly damaging Het
Mfge8 G A 7: 78,792,191 (GRCm39) R245C probably damaging Het
Mogat1 T G 1: 78,514,681 (GRCm39) N318K probably benign Het
Myh4 T A 11: 67,141,135 (GRCm39) S732R possibly damaging Het
Myt1l T A 12: 29,861,537 (GRCm39) D106E unknown Het
Ndc1 T C 4: 107,241,992 (GRCm39) F302L probably damaging Het
Ndrg4 C T 8: 96,438,956 (GRCm39) A290V probably benign Het
Nfia A T 4: 97,951,365 (GRCm39) K397N probably damaging Het
Nlrp4e A T 7: 23,020,458 (GRCm39) Q315L possibly damaging Het
Oga C A 19: 45,740,613 (GRCm39) K907N probably benign Het
Or10p22 A C 10: 128,826,721 (GRCm39) *313C probably null Het
Or1ad8 T A 11: 50,898,679 (GRCm39) N293K probably damaging Het
Peg3 T C 7: 6,710,780 (GRCm39) I1481V possibly damaging Het
Phldb2 C T 16: 45,595,413 (GRCm39) G883D probably benign Het
Pik3c2b T A 1: 133,022,564 (GRCm39) Y1169N probably damaging Het
Plcl1 A T 1: 55,734,997 (GRCm39) I113F probably damaging Het
Pomt2 T C 12: 87,171,610 (GRCm39) I457V probably benign Het
Ppil1 T C 17: 29,480,809 (GRCm39) N38S possibly damaging Het
Prf1 A G 10: 61,136,231 (GRCm39) N169S probably benign Het
Prmt8 A C 6: 127,703,486 (GRCm39) probably null Het
Ptprg T A 14: 12,154,360 (GRCm38) S694T probably benign Het
Rab12 A T 17: 66,807,315 (GRCm39) M138K possibly damaging Het
Reln T C 5: 22,160,093 (GRCm39) T2159A probably damaging Het
Retsat A T 6: 72,583,063 (GRCm39) Y36F probably damaging Het
Rgs14 A T 13: 55,526,696 (GRCm39) Q116L probably damaging Het
Rlbp1 A T 7: 79,025,684 (GRCm39) N252K probably damaging Het
Rtraf A G 14: 19,862,242 (GRCm39) L215P probably damaging Het
Sec1 A T 7: 45,328,789 (GRCm39) M86K probably benign Het
Sec24b A T 3: 129,834,665 (GRCm39) S42T possibly damaging Het
Serpinb9d T C 13: 33,380,500 (GRCm39) S129P probably damaging Het
Slc35f5 T G 1: 125,512,269 (GRCm39) D356E possibly damaging Het
Smpd4 T C 16: 17,460,365 (GRCm39) S694P probably damaging Het
Spag6 G T 2: 18,750,420 (GRCm39) probably null Het
Spata31d1c T C 13: 65,181,030 (GRCm39) I43T possibly damaging Het
Ssh1 T C 5: 114,090,081 (GRCm39) D314G possibly damaging Het
Tnfrsf17 G A 16: 11,137,595 (GRCm39) D111N probably benign Het
Ttn A G 2: 76,553,635 (GRCm39) I30994T probably damaging Het
Ttn A T 2: 76,614,320 (GRCm39) F8737L probably damaging Het
Ush1c G T 7: 45,845,152 (GRCm39) F890L probably benign Het
Usp36 C T 11: 118,162,957 (GRCm39) probably null Het
Vmn2r115 T C 17: 23,566,795 (GRCm39) Y436H probably benign Het
Vmn2r94 T A 17: 18,477,635 (GRCm39) M259L probably benign Het
Wwp1 T C 4: 19,659,698 (GRCm39) T197A probably benign Het
Zbtb37 T A 1: 160,847,814 (GRCm39) M398L probably benign Het
Zfp804b C T 5: 6,819,673 (GRCm39) C1130Y probably benign Het
Zfp9 A G 6: 118,441,712 (GRCm39) C317R probably damaging Het
Zscan20 T C 4: 128,480,334 (GRCm39) H719R probably damaging Het
Other mutations in Cntnap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Cntnap2 APN 6 45,992,197 (GRCm39) missense possibly damaging 0.92
IGL00657:Cntnap2 APN 6 46,965,721 (GRCm39) missense probably damaging 0.98
IGL00846:Cntnap2 APN 6 47,169,972 (GRCm39) missense probably benign 0.12
IGL00851:Cntnap2 APN 6 46,461,006 (GRCm39) missense probably benign
IGL00857:Cntnap2 APN 6 47,026,358 (GRCm39) missense probably benign 0.00
IGL01290:Cntnap2 APN 6 45,992,399 (GRCm39) missense probably benign 0.06
IGL01445:Cntnap2 APN 6 47,169,947 (GRCm39) missense probably benign 0.14
IGL01468:Cntnap2 APN 6 47,248,305 (GRCm39) nonsense probably null
IGL01859:Cntnap2 APN 6 46,965,655 (GRCm39) missense probably damaging 1.00
IGL02092:Cntnap2 APN 6 46,211,137 (GRCm39) missense probably damaging 1.00
IGL02239:Cntnap2 APN 6 46,998,588 (GRCm39) missense probably damaging 0.99
IGL02508:Cntnap2 APN 6 46,211,254 (GRCm39) missense probably damaging 1.00
IGL02530:Cntnap2 APN 6 46,998,670 (GRCm39) missense possibly damaging 0.48
IGL03013:Cntnap2 APN 6 47,072,483 (GRCm39) missense possibly damaging 0.66
BB004:Cntnap2 UTSW 6 47,072,621 (GRCm39) missense possibly damaging 0.93
BB014:Cntnap2 UTSW 6 47,072,621 (GRCm39) missense possibly damaging 0.93
IGL02802:Cntnap2 UTSW 6 46,147,179 (GRCm39) missense probably damaging 1.00
R0001:Cntnap2 UTSW 6 46,507,105 (GRCm39) missense probably benign 0.04
R0007:Cntnap2 UTSW 6 45,969,007 (GRCm39) missense possibly damaging 0.95
R0007:Cntnap2 UTSW 6 45,969,007 (GRCm39) missense possibly damaging 0.95
R0043:Cntnap2 UTSW 6 46,460,917 (GRCm39) missense probably benign 0.01
R0118:Cntnap2 UTSW 6 45,037,326 (GRCm39) splice site probably null
R0352:Cntnap2 UTSW 6 45,969,018 (GRCm39) splice site probably null
R0389:Cntnap2 UTSW 6 45,986,571 (GRCm39) missense probably benign 0.06
R0482:Cntnap2 UTSW 6 45,692,750 (GRCm39) missense probably benign 0.00
R0530:Cntnap2 UTSW 6 46,506,839 (GRCm39) nonsense probably null
R0611:Cntnap2 UTSW 6 47,072,483 (GRCm39) missense possibly damaging 0.66
R0630:Cntnap2 UTSW 6 46,965,694 (GRCm39) missense probably damaging 0.99
R0636:Cntnap2 UTSW 6 47,273,642 (GRCm39) splice site probably benign
R0976:Cntnap2 UTSW 6 47,248,164 (GRCm39) missense probably damaging 1.00
R1195:Cntnap2 UTSW 6 46,460,902 (GRCm39) missense probably benign
R1195:Cntnap2 UTSW 6 46,460,902 (GRCm39) missense probably benign
R1195:Cntnap2 UTSW 6 46,460,902 (GRCm39) missense probably benign
R1387:Cntnap2 UTSW 6 47,084,848 (GRCm39) missense probably benign 0.19
R1524:Cntnap2 UTSW 6 46,507,613 (GRCm39) missense probably damaging 1.00
R1609:Cntnap2 UTSW 6 45,992,264 (GRCm39) missense probably benign 0.13
R1757:Cntnap2 UTSW 6 46,736,763 (GRCm39) missense probably damaging 1.00
R1809:Cntnap2 UTSW 6 46,965,609 (GRCm39) missense probably damaging 0.99
R1813:Cntnap2 UTSW 6 46,507,567 (GRCm39) missense probably damaging 1.00
R2103:Cntnap2 UTSW 6 47,275,522 (GRCm39) missense probably damaging 1.00
R2133:Cntnap2 UTSW 6 47,275,379 (GRCm39) missense probably damaging 1.00
R3037:Cntnap2 UTSW 6 45,992,200 (GRCm39) missense possibly damaging 0.57
R3899:Cntnap2 UTSW 6 45,968,837 (GRCm39) missense probably benign 0.00
R4027:Cntnap2 UTSW 6 46,833,062 (GRCm39) missense probably benign
R4030:Cntnap2 UTSW 6 46,833,062 (GRCm39) missense probably benign
R4237:Cntnap2 UTSW 6 46,507,324 (GRCm39) intron probably benign
R4445:Cntnap2 UTSW 6 46,736,785 (GRCm39) missense probably benign 0.01
R4737:Cntnap2 UTSW 6 45,037,251 (GRCm39) missense possibly damaging 0.65
R4740:Cntnap2 UTSW 6 45,037,251 (GRCm39) missense possibly damaging 0.65
R4915:Cntnap2 UTSW 6 46,506,969 (GRCm39) intron probably benign
R4918:Cntnap2 UTSW 6 46,506,969 (GRCm39) intron probably benign
R4999:Cntnap2 UTSW 6 45,897,768 (GRCm39) missense probably damaging 0.96
R5373:Cntnap2 UTSW 6 47,084,903 (GRCm39) missense probably benign 0.00
R5374:Cntnap2 UTSW 6 47,084,903 (GRCm39) missense probably benign 0.00
R5742:Cntnap2 UTSW 6 45,897,860 (GRCm39) nonsense probably null
R5748:Cntnap2 UTSW 6 45,692,818 (GRCm39) missense probably damaging 1.00
R5765:Cntnap2 UTSW 6 46,506,749 (GRCm39) intron probably benign
R6118:Cntnap2 UTSW 6 47,170,011 (GRCm39) missense possibly damaging 0.81
R6181:Cntnap2 UTSW 6 46,736,742 (GRCm39) missense probably damaging 1.00
R6189:Cntnap2 UTSW 6 47,248,232 (GRCm39) missense probably damaging 1.00
R6262:Cntnap2 UTSW 6 45,037,046 (GRCm39) splice site probably null
R6385:Cntnap2 UTSW 6 46,833,114 (GRCm39) missense probably benign 0.00
R6555:Cntnap2 UTSW 6 46,736,694 (GRCm39) missense probably damaging 1.00
R6577:Cntnap2 UTSW 6 46,147,206 (GRCm39) missense probably benign 0.25
R6610:Cntnap2 UTSW 6 45,992,191 (GRCm39) missense probably benign 0.08
R6761:Cntnap2 UTSW 6 47,026,307 (GRCm39) missense probably benign 0.03
R7125:Cntnap2 UTSW 6 46,965,580 (GRCm39) missense probably benign 0.12
R7329:Cntnap2 UTSW 6 47,248,205 (GRCm39) missense possibly damaging 0.94
R7502:Cntnap2 UTSW 6 46,460,963 (GRCm39) missense possibly damaging 0.83
R7927:Cntnap2 UTSW 6 47,072,621 (GRCm39) missense possibly damaging 0.93
R8057:Cntnap2 UTSW 6 46,324,079 (GRCm39) missense probably damaging 0.98
R8261:Cntnap2 UTSW 6 47,072,627 (GRCm39) missense probably damaging 0.98
R8356:Cntnap2 UTSW 6 47,026,307 (GRCm39) missense probably benign 0.03
R8479:Cntnap2 UTSW 6 46,736,707 (GRCm39) missense probably benign 0.14
R8503:Cntnap2 UTSW 6 45,968,975 (GRCm39) missense probably damaging 1.00
R8698:Cntnap2 UTSW 6 47,026,156 (GRCm39) missense probably damaging 1.00
R8719:Cntnap2 UTSW 6 45,978,161 (GRCm39) missense probably damaging 1.00
R8816:Cntnap2 UTSW 6 46,833,076 (GRCm39) missense possibly damaging 0.72
R8987:Cntnap2 UTSW 6 46,460,983 (GRCm39) missense probably benign 0.01
R9000:Cntnap2 UTSW 6 46,461,139 (GRCm39) intron probably benign
R9209:Cntnap2 UTSW 6 47,026,183 (GRCm39) missense probably damaging 1.00
R9253:Cntnap2 UTSW 6 45,978,112 (GRCm39) missense probably benign 0.00
R9310:Cntnap2 UTSW 6 45,978,281 (GRCm39) missense probably damaging 1.00
R9395:Cntnap2 UTSW 6 45,978,244 (GRCm39) missense probably damaging 0.98
R9462:Cntnap2 UTSW 6 46,211,217 (GRCm39) missense probably damaging 0.99
R9526:Cntnap2 UTSW 6 45,992,165 (GRCm39) missense probably damaging 1.00
R9600:Cntnap2 UTSW 6 45,969,009 (GRCm39) missense probably damaging 0.98
R9621:Cntnap2 UTSW 6 46,965,726 (GRCm39) missense probably damaging 0.98
R9738:Cntnap2 UTSW 6 45,992,373 (GRCm39) frame shift probably null
R9745:Cntnap2 UTSW 6 46,211,100 (GRCm39) missense probably benign 0.01
R9775:Cntnap2 UTSW 6 47,026,261 (GRCm39) missense probably damaging 1.00
RF022:Cntnap2 UTSW 6 46,998,599 (GRCm39) missense probably damaging 1.00
X0018:Cntnap2 UTSW 6 45,986,452 (GRCm39) missense possibly damaging 0.53
X0063:Cntnap2 UTSW 6 46,998,688 (GRCm39) missense possibly damaging 0.92
X0066:Cntnap2 UTSW 6 46,211,179 (GRCm39) missense probably benign 0.03
Z1176:Cntnap2 UTSW 6 47,248,082 (GRCm39) missense probably benign 0.00
Z1177:Cntnap2 UTSW 6 45,992,233 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TGCTAGACTGAGACAATCCCTACACTC -3'
(R):5'- CCAGGCAACTTAATGATATCCTGCCAC -3'

Sequencing Primer
(F):5'- TGAGCTTTCAGGAATCTCCACAG -3'
(R):5'- gcaaggacctagatttgatccac -3'
Posted On 2014-05-14