Incidental Mutation 'R1716:Ndrg4'
ID191025
Institutional Source Beutler Lab
Gene Symbol Ndrg4
Ensembl Gene ENSMUSG00000036564
Gene NameN-myc downstream regulated gene 4
SynonymsD8Bwg1337e, Ndr1-rs, SMAP-8, Ndr4
MMRRC Submission 039749-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1716 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location95676980-95715119 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 95712328 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 290 (A290V)
Ref Sequence ENSEMBL: ENSMUSP00000072883 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034096] [ENSMUST00000041318] [ENSMUST00000073139] [ENSMUST00000080666] [ENSMUST00000141900] [ENSMUST00000148727] [ENSMUST00000160964] [ENSMUST00000162578] [ENSMUST00000166358] [ENSMUST00000212160]
Predicted Effect probably benign
Transcript: ENSMUST00000034096
SMART Domains Protein: ENSMUSP00000034096
Gene: ENSMUSG00000031671

DomainStartEndE-ValueType
low complexity region 18 34 N/A INTRINSIC
SET 62 293 1.84e0 SMART
Pfam:Rubis-subs-bind 330 465 1.3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000041318
AA Change: A342V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000036226
Gene: ENSMUSG00000036564
AA Change: A342V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Ndr 60 342 3.1e-126 PFAM
low complexity region 360 375 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073139
AA Change: A290V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000072883
Gene: ENSMUSG00000036564
AA Change: A290V

DomainStartEndE-ValueType
Pfam:Ndr 8 290 2e-126 PFAM
Pfam:Abhydrolase_6 43 278 1.2e-16 PFAM
low complexity region 308 323 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000080666
SMART Domains Protein: ENSMUSP00000079495
Gene: ENSMUSG00000036564

DomainStartEndE-ValueType
Pfam:Ndr 8 290 9.9e-127 PFAM
Pfam:Abhydrolase_6 43 278 1.1e-16 PFAM
low complexity region 295 310 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126888
Predicted Effect probably benign
Transcript: ENSMUST00000141900
Predicted Effect probably benign
Transcript: ENSMUST00000148727
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154052
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154593
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159632
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159851
Predicted Effect probably benign
Transcript: ENSMUST00000160915
Predicted Effect probably benign
Transcript: ENSMUST00000160964
SMART Domains Protein: ENSMUSP00000125703
Gene: ENSMUSG00000036564

DomainStartEndE-ValueType
Pfam:Ndr 40 225 6.8e-85 PFAM
Pfam:Abhydrolase_6 75 223 5.3e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161314
Predicted Effect probably benign
Transcript: ENSMUST00000162578
AA Change: A47V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000166358
SMART Domains Protein: ENSMUSP00000131203
Gene: ENSMUSG00000036564

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000212160
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the N-myc downregulated gene family which belongs to the alpha/beta hydrolase superfamily. The protein encoded by this gene is a cytoplasmic protein that is required for cell cycle progression and survival in primary astrocytes and may be involved in the regulation of mitogenic signalling in vascular smooth muscles cells. Alternative splicing results in multiple transcripts encoding different isoforms.[provided by RefSeq, Jun 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit spatial learning deficits and increased susceptibility to ischemic brain injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 79,082,198 T2A unknown Het
Adgrf3 T A 5: 30,197,551 Q493L probably benign Het
Ak6 T C 13: 100,655,669 S207P probably benign Het
Ang A G 14: 51,101,480 D26G probably benign Het
Ang T C 14: 51,101,500 F33L probably damaging Het
Arhgef38 T A 3: 133,140,837 Y389F probably benign Het
Arhgef7 C A 8: 11,808,713 probably null Het
Bicd2 C A 13: 49,378,310 H343N probably benign Het
Casp4 G A 9: 5,308,919 probably null Het
Cd22 A G 7: 30,877,678 F68S probably damaging Het
Cd46 T A 1: 195,077,809 Q245L probably benign Het
Cntnap2 A T 6: 47,107,892 R1096* probably null Het
Cntnap3 A G 13: 64,762,002 V763A probably damaging Het
Cyp3a11 T C 5: 145,868,966 T171A probably benign Het
Defa30 A G 8: 21,135,415 Y65C probably damaging Het
Defb18 A T 1: 18,236,651 M27K probably benign Het
Dnah17 A G 11: 118,032,598 S4071P probably benign Het
Dnah7b T A 1: 46,191,783 D1400E probably damaging Het
Dpysl5 C T 5: 30,777,994 T147I probably benign Het
Dsg4 C T 18: 20,462,461 R574* probably null Het
Epm2a A G 10: 11,448,836 E223G probably benign Het
Etl4 T C 2: 20,743,681 S75P probably damaging Het
Fam189a1 A T 7: 64,776,885 probably null Het
Fbxw15 T A 9: 109,557,136 M312L probably benign Het
Fcgr4 C T 1: 171,020,103 T90I probably damaging Het
Fras1 T A 5: 96,552,725 D201E probably benign Het
Gadl1 A T 9: 116,006,508 K335* probably null Het
Gcsam T G 16: 45,619,993 V133G probably damaging Het
Gml G T 15: 74,813,816 L107I possibly damaging Het
Golga2 T A 2: 32,302,897 L409Q probably damaging Het
Gtf2a1l A T 17: 88,694,580 Q241L probably benign Het
Gtf3c3 A G 1: 54,399,260 Y799H probably damaging Het
Guca1b T G 17: 47,391,201 probably benign Het
Igdcc4 C A 9: 65,126,897 H617Q probably damaging Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Itga2b A C 11: 102,460,777 I574S probably benign Het
Kcnk7 A T 19: 5,706,831 I283F probably damaging Het
Kirrel3 T A 9: 35,023,547 L450M probably damaging Het
Lmntd1 A T 6: 145,419,874 S176R probably damaging Het
Lrrc39 C T 3: 116,579,567 T292I probably benign Het
Ltbp1 A T 17: 75,315,024 H801L probably benign Het
Macf1 T A 4: 123,401,403 Q3318L probably damaging Het
Man1b1 T A 2: 25,345,020 N282K probably benign Het
Map2k6 A T 11: 110,497,901 E223V probably damaging Het
Marf1 C A 16: 14,142,586 R531S possibly damaging Het
Mfge8 G A 7: 79,142,443 R245C probably damaging Het
Mgea5 C A 19: 45,752,174 K907N probably benign Het
Mogat1 T G 1: 78,538,044 N318K probably benign Het
Myh4 T A 11: 67,250,309 S732R possibly damaging Het
Myt1l T A 12: 29,811,538 D106E unknown Het
Ndc1 T C 4: 107,384,795 F302L probably damaging Het
Nfia A T 4: 98,063,128 K397N probably damaging Het
Nlrp4e A T 7: 23,321,033 Q315L possibly damaging Het
Olfr51 T A 11: 51,007,852 N293K probably damaging Het
Olfr9 A C 10: 128,990,852 *313C probably null Het
Peg3 T C 7: 6,707,781 I1481V possibly damaging Het
Phldb2 C T 16: 45,775,050 G883D probably benign Het
Pik3c2b T A 1: 133,094,826 Y1169N probably damaging Het
Plcl1 A T 1: 55,695,838 I113F probably damaging Het
Pomt2 T C 12: 87,124,836 I457V probably benign Het
Ppil1 T C 17: 29,261,835 N38S possibly damaging Het
Prf1 A G 10: 61,300,452 N169S probably benign Het
Prmt8 A C 6: 127,726,523 probably null Het
Ptprg T A 14: 12,154,360 S694T probably benign Het
Rab12 A T 17: 66,500,320 M138K possibly damaging Het
Reln T C 5: 21,955,095 T2159A probably damaging Het
Retsat A T 6: 72,606,080 Y36F probably damaging Het
Rgs14 A T 13: 55,378,883 Q116L probably damaging Het
Rlbp1 A T 7: 79,375,936 N252K probably damaging Het
Rtraf A G 14: 19,812,174 L215P probably damaging Het
Sec1 A T 7: 45,679,365 M86K probably benign Het
Sec24b A T 3: 130,041,016 S42T possibly damaging Het
Serpinb9d T C 13: 33,196,517 S129P probably damaging Het
Slc35f5 T G 1: 125,584,532 D356E possibly damaging Het
Smpd4 T C 16: 17,642,501 S694P probably damaging Het
Spag6 G T 2: 18,745,609 probably null Het
Spata31d1c T C 13: 65,033,216 I43T possibly damaging Het
Ssh1 T C 5: 113,952,020 D314G possibly damaging Het
Tnfrsf17 G A 16: 11,319,731 D111N probably benign Het
Ttn A G 2: 76,723,291 I30994T probably damaging Het
Ttn A T 2: 76,783,976 F8737L probably damaging Het
Ush1c G T 7: 46,195,728 F890L probably benign Het
Usp36 C T 11: 118,272,131 probably null Het
Vmn2r115 T C 17: 23,347,821 Y436H probably benign Het
Vmn2r94 T A 17: 18,257,373 M259L probably benign Het
Wwp1 T C 4: 19,659,698 T197A probably benign Het
Zbtb37 T A 1: 161,020,244 M398L probably benign Het
Zfp804b C T 5: 6,769,673 C1130Y probably benign Het
Zfp9 A G 6: 118,464,751 C317R probably damaging Het
Zscan20 T C 4: 128,586,541 H719R probably damaging Het
Other mutations in Ndrg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01504:Ndrg4 APN 8 95706266 missense probably damaging 1.00
IGL01832:Ndrg4 APN 8 95713319 missense probably damaging 1.00
R0325:Ndrg4 UTSW 8 95710935 missense probably damaging 1.00
R1710:Ndrg4 UTSW 8 95710686 missense probably damaging 1.00
R2393:Ndrg4 UTSW 8 95706211 nonsense probably null
R2897:Ndrg4 UTSW 8 95678386 splice site probably null
R2898:Ndrg4 UTSW 8 95678386 splice site probably null
R5838:Ndrg4 UTSW 8 95706793 missense probably damaging 1.00
R6264:Ndrg4 UTSW 8 95709768 missense probably damaging 0.99
R6893:Ndrg4 UTSW 8 95706601 nonsense probably null
R8070:Ndrg4 UTSW 8 95700128 missense possibly damaging 0.69
Z1177:Ndrg4 UTSW 8 95710961 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TTCAAGGGAACTACGCCAGGCATC -3'
(R):5'- GGGGCTTTGAGCTGAGCATAACAC -3'

Sequencing Primer
(F):5'- GTGAGAATTCCCAGACAGCTTC -3'
(R):5'- TGAGCATAACACAAGAAGGTTCC -3'
Posted On2014-05-14