Incidental Mutation 'R1716:Kirrel3'
ID191028
Institutional Source Beutler Lab
Gene Symbol Kirrel3
Ensembl Gene ENSMUSG00000032036
Gene Namekirre like nephrin family adhesion molecule 3
Synonyms2900036G11Rik, Neph2, 1500010O20Rik
MMRRC Submission 039749-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.216) question?
Stock #R1716 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location34485894-35036716 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 35023547 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Methionine at position 450 (L450M)
Ref Sequence ENSEMBL: ENSMUSP00000139714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045091] [ENSMUST00000115148] [ENSMUST00000187182] [ENSMUST00000187625] [ENSMUST00000188658] [ENSMUST00000188933] [ENSMUST00000190549]
Predicted Effect probably damaging
Transcript: ENSMUST00000045091
AA Change: L450M

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000048863
Gene: ENSMUSG00000032036
AA Change: L450M

DomainStartEndE-ValueType
IG 21 111 1.35e-9 SMART
IG 122 214 2.56e-1 SMART
Pfam:Ig_2 217 298 2.1e-6 PFAM
IGc2 314 372 1.66e-9 SMART
IG 392 484 1.06e-2 SMART
transmembrane domain 491 513 N/A INTRINSIC
low complexity region 568 581 N/A INTRINSIC
low complexity region 700 717 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115148
AA Change: L483M

PolyPhen 2 Score 0.512 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000110801
Gene: ENSMUSG00000032036
AA Change: L483M

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IG 54 144 1.35e-9 SMART
IG 155 247 2.56e-1 SMART
Pfam:Ig_3 249 318 7.2e-6 PFAM
IGc2 347 405 1.66e-9 SMART
IG 425 517 1.06e-2 SMART
transmembrane domain 524 546 N/A INTRINSIC
low complexity region 601 614 N/A INTRINSIC
low complexity region 733 750 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000187182
AA Change: L457M

PolyPhen 2 Score 0.500 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000140219
Gene: ENSMUSG00000032036
AA Change: L457M

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 28 118 1.35e-9 SMART
IG 129 221 2.56e-1 SMART
Pfam:Ig_2 224 305 2.3e-6 PFAM
IGc2 321 379 1.66e-9 SMART
IG 399 491 1.06e-2 SMART
transmembrane domain 510 532 N/A INTRINSIC
low complexity region 612 625 N/A INTRINSIC
low complexity region 744 761 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000187625
AA Change: L450M

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139951
Gene: ENSMUSG00000032036
AA Change: L450M

DomainStartEndE-ValueType
IG 21 111 1.35e-9 SMART
IG 122 214 2.56e-1 SMART
Pfam:Ig_2 217 298 2.1e-6 PFAM
IGc2 314 372 1.66e-9 SMART
IG 392 484 1.06e-2 SMART
transmembrane domain 491 513 N/A INTRINSIC
low complexity region 568 581 N/A INTRINSIC
low complexity region 700 717 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000188658
AA Change: L98M

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140086
Gene: ENSMUSG00000032036
AA Change: L98M

DomainStartEndE-ValueType
Pfam:Ig_2 1 31 1.4e-1 PFAM
IG 40 132 4.5e-5 SMART
transmembrane domain 151 173 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000188933
AA Change: L450M

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139418
Gene: ENSMUSG00000032036
AA Change: L450M

DomainStartEndE-ValueType
IG 21 111 5.7e-12 SMART
IG 122 214 1.1e-3 SMART
Pfam:Ig_2 217 298 3.7e-5 PFAM
IGc2 314 372 6.8e-12 SMART
IG 392 484 4.5e-5 SMART
transmembrane domain 503 525 N/A INTRINSIC
low complexity region 580 593 N/A INTRINSIC
low complexity region 712 729 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000190549
AA Change: L450M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000139714
Gene: ENSMUSG00000032036
AA Change: L450M

DomainStartEndE-ValueType
IG 21 111 5.7e-12 SMART
IG 122 214 1.1e-3 SMART
Pfam:Ig_2 217 298 2.6e-5 PFAM
IGc2 314 372 6.8e-12 SMART
IG 392 484 4.5e-5 SMART
transmembrane domain 491 513 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the nephrin-like protein family. These proteins are expressed in fetal and adult brain, and also in podocytes of kidney glomeruli. The cytoplasmic domains of these proteins interact with the C-terminus of podocin, also expressed in the podocytes, cells involved in ensuring size- and charge-selective ultrafiltration. Mutations in this gene are associated with mental retardation autosomal dominant type 4 (MRD4). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired accessory olfactory bulb formation with reduced coalescence of vomeronasal sensory neuron axons in the posterior accessory olfactory bulb, loss of male-male aggression and abnormal male sexual response to a male intruder mouse. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 79,082,198 T2A unknown Het
Adgrf3 T A 5: 30,197,551 Q493L probably benign Het
Ak6 T C 13: 100,655,669 S207P probably benign Het
Ang A G 14: 51,101,480 D26G probably benign Het
Ang T C 14: 51,101,500 F33L probably damaging Het
Arhgef38 T A 3: 133,140,837 Y389F probably benign Het
Arhgef7 C A 8: 11,808,713 probably null Het
Bicd2 C A 13: 49,378,310 H343N probably benign Het
Casp4 G A 9: 5,308,919 probably null Het
Cd22 A G 7: 30,877,678 F68S probably damaging Het
Cd46 T A 1: 195,077,809 Q245L probably benign Het
Cntnap2 A T 6: 47,107,892 R1096* probably null Het
Cntnap3 A G 13: 64,762,002 V763A probably damaging Het
Cyp3a11 T C 5: 145,868,966 T171A probably benign Het
Defa30 A G 8: 21,135,415 Y65C probably damaging Het
Defb18 A T 1: 18,236,651 M27K probably benign Het
Dnah17 A G 11: 118,032,598 S4071P probably benign Het
Dnah7b T A 1: 46,191,783 D1400E probably damaging Het
Dpysl5 C T 5: 30,777,994 T147I probably benign Het
Dsg4 C T 18: 20,462,461 R574* probably null Het
Epm2a A G 10: 11,448,836 E223G probably benign Het
Etl4 T C 2: 20,743,681 S75P probably damaging Het
Fam189a1 A T 7: 64,776,885 probably null Het
Fbxw15 T A 9: 109,557,136 M312L probably benign Het
Fcgr4 C T 1: 171,020,103 T90I probably damaging Het
Fras1 T A 5: 96,552,725 D201E probably benign Het
Gadl1 A T 9: 116,006,508 K335* probably null Het
Gcsam T G 16: 45,619,993 V133G probably damaging Het
Gml G T 15: 74,813,816 L107I possibly damaging Het
Golga2 T A 2: 32,302,897 L409Q probably damaging Het
Gtf2a1l A T 17: 88,694,580 Q241L probably benign Het
Gtf3c3 A G 1: 54,399,260 Y799H probably damaging Het
Guca1b T G 17: 47,391,201 probably benign Het
Igdcc4 C A 9: 65,126,897 H617Q probably damaging Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Itga2b A C 11: 102,460,777 I574S probably benign Het
Kcnk7 A T 19: 5,706,831 I283F probably damaging Het
Lmntd1 A T 6: 145,419,874 S176R probably damaging Het
Lrrc39 C T 3: 116,579,567 T292I probably benign Het
Ltbp1 A T 17: 75,315,024 H801L probably benign Het
Macf1 T A 4: 123,401,403 Q3318L probably damaging Het
Man1b1 T A 2: 25,345,020 N282K probably benign Het
Map2k6 A T 11: 110,497,901 E223V probably damaging Het
Marf1 C A 16: 14,142,586 R531S possibly damaging Het
Mfge8 G A 7: 79,142,443 R245C probably damaging Het
Mgea5 C A 19: 45,752,174 K907N probably benign Het
Mogat1 T G 1: 78,538,044 N318K probably benign Het
Myh4 T A 11: 67,250,309 S732R possibly damaging Het
Myt1l T A 12: 29,811,538 D106E unknown Het
Ndc1 T C 4: 107,384,795 F302L probably damaging Het
Ndrg4 C T 8: 95,712,328 A290V probably benign Het
Nfia A T 4: 98,063,128 K397N probably damaging Het
Nlrp4e A T 7: 23,321,033 Q315L possibly damaging Het
Olfr51 T A 11: 51,007,852 N293K probably damaging Het
Olfr9 A C 10: 128,990,852 *313C probably null Het
Peg3 T C 7: 6,707,781 I1481V possibly damaging Het
Phldb2 C T 16: 45,775,050 G883D probably benign Het
Pik3c2b T A 1: 133,094,826 Y1169N probably damaging Het
Plcl1 A T 1: 55,695,838 I113F probably damaging Het
Pomt2 T C 12: 87,124,836 I457V probably benign Het
Ppil1 T C 17: 29,261,835 N38S possibly damaging Het
Prf1 A G 10: 61,300,452 N169S probably benign Het
Prmt8 A C 6: 127,726,523 probably null Het
Ptprg T A 14: 12,154,360 S694T probably benign Het
Rab12 A T 17: 66,500,320 M138K possibly damaging Het
Reln T C 5: 21,955,095 T2159A probably damaging Het
Retsat A T 6: 72,606,080 Y36F probably damaging Het
Rgs14 A T 13: 55,378,883 Q116L probably damaging Het
Rlbp1 A T 7: 79,375,936 N252K probably damaging Het
Rtraf A G 14: 19,812,174 L215P probably damaging Het
Sec1 A T 7: 45,679,365 M86K probably benign Het
Sec24b A T 3: 130,041,016 S42T possibly damaging Het
Serpinb9d T C 13: 33,196,517 S129P probably damaging Het
Slc35f5 T G 1: 125,584,532 D356E possibly damaging Het
Smpd4 T C 16: 17,642,501 S694P probably damaging Het
Spag6 G T 2: 18,745,609 probably null Het
Spata31d1c T C 13: 65,033,216 I43T possibly damaging Het
Ssh1 T C 5: 113,952,020 D314G possibly damaging Het
Tnfrsf17 G A 16: 11,319,731 D111N probably benign Het
Ttn A G 2: 76,723,291 I30994T probably damaging Het
Ttn A T 2: 76,783,976 F8737L probably damaging Het
Ush1c G T 7: 46,195,728 F890L probably benign Het
Usp36 C T 11: 118,272,131 probably null Het
Vmn2r115 T C 17: 23,347,821 Y436H probably benign Het
Vmn2r94 T A 17: 18,257,373 M259L probably benign Het
Wwp1 T C 4: 19,659,698 T197A probably benign Het
Zbtb37 T A 1: 161,020,244 M398L probably benign Het
Zfp804b C T 5: 6,769,673 C1130Y probably benign Het
Zfp9 A G 6: 118,464,751 C317R probably damaging Het
Zscan20 T C 4: 128,586,541 H719R probably damaging Het
Other mutations in Kirrel3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00919:Kirrel3 APN 9 35015253 critical splice acceptor site probably null
IGL01369:Kirrel3 APN 9 35016441 missense probably benign 0.07
IGL01837:Kirrel3 APN 9 35034928 missense probably damaging 1.00
IGL01950:Kirrel3 APN 9 35028329 splice site probably benign
IGL01973:Kirrel3 APN 9 35016468 missense probably damaging 1.00
IGL01994:Kirrel3 APN 9 35020133 missense possibly damaging 0.71
IGL03184:Kirrel3 APN 9 35007756 missense probably damaging 1.00
R0033:Kirrel3 UTSW 9 35000963 missense probably benign 0.06
R0033:Kirrel3 UTSW 9 35000963 missense probably benign 0.06
R0038:Kirrel3 UTSW 9 34911770 splice site probably null
R0038:Kirrel3 UTSW 9 34911770 splice site probably null
R0390:Kirrel3 UTSW 9 35020163 missense probably damaging 1.00
R0627:Kirrel3 UTSW 9 35035174 missense probably damaging 1.00
R0786:Kirrel3 UTSW 9 35034865 missense probably damaging 1.00
R0920:Kirrel3 UTSW 9 35028352 missense probably damaging 1.00
R0962:Kirrel3 UTSW 9 35000997 missense possibly damaging 0.95
R2010:Kirrel3 UTSW 9 34939198 missense probably damaging 1.00
R4289:Kirrel3 UTSW 9 35023473 missense probably benign 0.44
R4888:Kirrel3 UTSW 9 35013305 missense probably damaging 1.00
R4970:Kirrel3 UTSW 9 34944439 missense possibly damaging 0.88
R5121:Kirrel3 UTSW 9 35013305 missense probably damaging 1.00
R5368:Kirrel3 UTSW 9 35007738 missense probably damaging 1.00
R5572:Kirrel3 UTSW 9 35000948 missense probably damaging 1.00
R5707:Kirrel3 UTSW 9 35013276 missense probably damaging 1.00
R6302:Kirrel3 UTSW 9 35007749 missense probably damaging 1.00
R6449:Kirrel3 UTSW 9 34990973 missense probably benign
R6908:Kirrel3 UTSW 9 35013401 missense possibly damaging 0.86
R6967:Kirrel3 UTSW 9 35034906 missense probably damaging 1.00
R7578:Kirrel3 UTSW 9 34939112 missense probably damaging 1.00
R7861:Kirrel3 UTSW 9 35020123 missense possibly damaging 0.79
R8094:Kirrel3 UTSW 9 35035164 missense probably damaging 1.00
R8383:Kirrel3 UTSW 9 35029883 missense probably null 0.89
R8494:Kirrel3 UTSW 9 34991045 missense probably benign 0.03
R8955:Kirrel3 UTSW 9 34944442 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCACATGCTGACCATATGTTTGACA -3'
(R):5'- CAGAGGGCATCACTCGGAGTATCT -3'

Sequencing Primer
(F):5'- ATGTGGCAGTGATTGGGAAC -3'
(R):5'- AAGGTGAGGCTGCATTGC -3'
Posted On2014-05-14