Incidental Mutation 'R1716:Epm2a'
ID191035
Institutional Source Beutler Lab
Gene Symbol Epm2a
Ensembl Gene ENSMUSG00000055493
Gene Nameepilepsy, progressive myoclonic epilepsy, type 2 gene alpha
SynonymsTG-B, laforin, Tg(TcraK,TcrbK)TG-BFlv
MMRRC Submission 039749-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.269) question?
Stock #R1716 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location11343404-11459644 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 11448836 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 223 (E223G)
Ref Sequence ENSEMBL: ENSMUSP00000066050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069106]
Predicted Effect probably benign
Transcript: ENSMUST00000069106
AA Change: E223G

PolyPhen 2 Score 0.310 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000066050
Gene: ENSMUSG00000055493
AA Change: E223G

DomainStartEndE-ValueType
CBM_2 4 115 4.89e-14 SMART
Pfam:DSPc 163 314 1.9e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161438
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a dual-specificity phosphatase that associates with polyribosomes. The encoded protein may be involved in the regulation of glycogen metabolism. Mutations in this gene have been associated with myoclonic epilepsy of Lafora. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit behavioral deficits, ataxia, myoclonus epilepsy, and widespread degeneration of neurons in the presence of only a few small Lafora inclusions, providing a putative mouse model of human Lafora disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 79,082,198 T2A unknown Het
Adgrf3 T A 5: 30,197,551 Q493L probably benign Het
Ak6 T C 13: 100,655,669 S207P probably benign Het
Ang A G 14: 51,101,480 D26G probably benign Het
Ang T C 14: 51,101,500 F33L probably damaging Het
Arhgef38 T A 3: 133,140,837 Y389F probably benign Het
Arhgef7 C A 8: 11,808,713 probably null Het
Bicd2 C A 13: 49,378,310 H343N probably benign Het
Casp4 G A 9: 5,308,919 probably null Het
Cd22 A G 7: 30,877,678 F68S probably damaging Het
Cd46 T A 1: 195,077,809 Q245L probably benign Het
Cntnap2 A T 6: 47,107,892 R1096* probably null Het
Cntnap3 A G 13: 64,762,002 V763A probably damaging Het
Cyp3a11 T C 5: 145,868,966 T171A probably benign Het
Defa30 A G 8: 21,135,415 Y65C probably damaging Het
Defb18 A T 1: 18,236,651 M27K probably benign Het
Dnah17 A G 11: 118,032,598 S4071P probably benign Het
Dnah7b T A 1: 46,191,783 D1400E probably damaging Het
Dpysl5 C T 5: 30,777,994 T147I probably benign Het
Dsg4 C T 18: 20,462,461 R574* probably null Het
Etl4 T C 2: 20,743,681 S75P probably damaging Het
Fam189a1 A T 7: 64,776,885 probably null Het
Fbxw15 T A 9: 109,557,136 M312L probably benign Het
Fcgr4 C T 1: 171,020,103 T90I probably damaging Het
Fras1 T A 5: 96,552,725 D201E probably benign Het
Gadl1 A T 9: 116,006,508 K335* probably null Het
Gcsam T G 16: 45,619,993 V133G probably damaging Het
Gml G T 15: 74,813,816 L107I possibly damaging Het
Golga2 T A 2: 32,302,897 L409Q probably damaging Het
Gtf2a1l A T 17: 88,694,580 Q241L probably benign Het
Gtf3c3 A G 1: 54,399,260 Y799H probably damaging Het
Guca1b T G 17: 47,391,201 probably benign Het
Igdcc4 C A 9: 65,126,897 H617Q probably damaging Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Itga2b A C 11: 102,460,777 I574S probably benign Het
Kcnk7 A T 19: 5,706,831 I283F probably damaging Het
Kirrel3 T A 9: 35,023,547 L450M probably damaging Het
Lmntd1 A T 6: 145,419,874 S176R probably damaging Het
Lrrc39 C T 3: 116,579,567 T292I probably benign Het
Ltbp1 A T 17: 75,315,024 H801L probably benign Het
Macf1 T A 4: 123,401,403 Q3318L probably damaging Het
Man1b1 T A 2: 25,345,020 N282K probably benign Het
Map2k6 A T 11: 110,497,901 E223V probably damaging Het
Marf1 C A 16: 14,142,586 R531S possibly damaging Het
Mfge8 G A 7: 79,142,443 R245C probably damaging Het
Mgea5 C A 19: 45,752,174 K907N probably benign Het
Mogat1 T G 1: 78,538,044 N318K probably benign Het
Myh4 T A 11: 67,250,309 S732R possibly damaging Het
Myt1l T A 12: 29,811,538 D106E unknown Het
Ndc1 T C 4: 107,384,795 F302L probably damaging Het
Ndrg4 C T 8: 95,712,328 A290V probably benign Het
Nfia A T 4: 98,063,128 K397N probably damaging Het
Nlrp4e A T 7: 23,321,033 Q315L possibly damaging Het
Olfr51 T A 11: 51,007,852 N293K probably damaging Het
Olfr9 A C 10: 128,990,852 *313C probably null Het
Peg3 T C 7: 6,707,781 I1481V possibly damaging Het
Phldb2 C T 16: 45,775,050 G883D probably benign Het
Pik3c2b T A 1: 133,094,826 Y1169N probably damaging Het
Plcl1 A T 1: 55,695,838 I113F probably damaging Het
Pomt2 T C 12: 87,124,836 I457V probably benign Het
Ppil1 T C 17: 29,261,835 N38S possibly damaging Het
Prf1 A G 10: 61,300,452 N169S probably benign Het
Prmt8 A C 6: 127,726,523 probably null Het
Ptprg T A 14: 12,154,360 S694T probably benign Het
Rab12 A T 17: 66,500,320 M138K possibly damaging Het
Reln T C 5: 21,955,095 T2159A probably damaging Het
Retsat A T 6: 72,606,080 Y36F probably damaging Het
Rgs14 A T 13: 55,378,883 Q116L probably damaging Het
Rlbp1 A T 7: 79,375,936 N252K probably damaging Het
Rtraf A G 14: 19,812,174 L215P probably damaging Het
Sec1 A T 7: 45,679,365 M86K probably benign Het
Sec24b A T 3: 130,041,016 S42T possibly damaging Het
Serpinb9d T C 13: 33,196,517 S129P probably damaging Het
Slc35f5 T G 1: 125,584,532 D356E possibly damaging Het
Smpd4 T C 16: 17,642,501 S694P probably damaging Het
Spag6 G T 2: 18,745,609 probably null Het
Spata31d1c T C 13: 65,033,216 I43T possibly damaging Het
Ssh1 T C 5: 113,952,020 D314G possibly damaging Het
Tnfrsf17 G A 16: 11,319,731 D111N probably benign Het
Ttn A G 2: 76,723,291 I30994T probably damaging Het
Ttn A T 2: 76,783,976 F8737L probably damaging Het
Ush1c G T 7: 46,195,728 F890L probably benign Het
Usp36 C T 11: 118,272,131 probably null Het
Vmn2r115 T C 17: 23,347,821 Y436H probably benign Het
Vmn2r94 T A 17: 18,257,373 M259L probably benign Het
Wwp1 T C 4: 19,659,698 T197A probably benign Het
Zbtb37 T A 1: 161,020,244 M398L probably benign Het
Zfp804b C T 5: 6,769,673 C1130Y probably benign Het
Zfp9 A G 6: 118,464,751 C317R probably damaging Het
Zscan20 T C 4: 128,586,541 H719R probably damaging Het
Other mutations in Epm2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00596:Epm2a APN 10 11448640 critical splice acceptor site probably null
IGL01925:Epm2a APN 10 11448758 missense possibly damaging 0.93
IGL02612:Epm2a APN 10 11457236 missense probably damaging 1.00
IGL03052:Epm2a UTSW 10 11457230 missense possibly damaging 0.95
R1432:Epm2a UTSW 10 11390843 missense probably damaging 0.99
R1785:Epm2a UTSW 10 11343682 missense probably benign
R2132:Epm2a UTSW 10 11343682 missense probably benign
R2133:Epm2a UTSW 10 11343682 missense probably benign
R3715:Epm2a UTSW 10 11343676 missense probably benign 0.01
R4794:Epm2a UTSW 10 11390853 missense probably benign 0.01
R5222:Epm2a UTSW 10 11448749 missense probably damaging 0.99
R5254:Epm2a UTSW 10 11457345 missense probably benign 0.00
R6608:Epm2a UTSW 10 11390987 critical splice donor site probably null
R6941:Epm2a UTSW 10 11391085 splice site probably null
R7211:Epm2a UTSW 10 11343675 missense probably benign 0.00
R7440:Epm2a UTSW 10 11390875 nonsense probably null
R7740:Epm2a UTSW 10 11390940 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- CGCCAACTGGAACATGTGACCATC -3'
(R):5'- GCATCACGGCCTCAAAAGCCTTTC -3'

Sequencing Primer
(F):5'- TGGAACATGTGACCATCAAACTG -3'
(R):5'- TAGGGACTGTATGCTCCATACAC -3'
Posted On2014-05-14